Cistus salviifolius
speciesAt a glance
Occurrence records131 563
Data sources12
Biological traits41
DNA specimens16
eDNA detections13
Sources12 archives
Databases and archives Cistus salviifolius's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility131 563 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics16 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Chemical compositionLOTUS2 compounds
Occurrence & distributionGBIF131 563 records
Environmental DNA1 datasets · 1 countries13 detections
DNA & barcodingBOLD · NCBI16 specimens
Genome at a glanceCCDB · GoaT2.3 Gbp
01Narrative
Le Ciste à feuilles de sauge ou Ciste femelle est un arbrisseau à fleurs blanches, avec des feuilles gaufrées, plus larges que celles du ciste de Montpellier, de la famille des Cistaceae. Il est appelé en corse mucchju albellu.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology11
Fruit length6 mm
Leaf length9.75 mm
Leaf size330 mm²
Leaf width15.5 mm
Plant height0.5 m
⚠ sources differ — AusTraits: 0.5 m · TRY: 0.545 m
Plant height generative0.531 m
Plant height max1 m
Seed length1.5 mm
Seed mass1.05 mg
Seed mass max1.2 mg
Seed mass min0.74 mg
Life cycle & reproduction8
Deciduousnessevergreen
Dispersal typeself
Flowering endJun
Flowering startMay
Life formshrub
Life spanperennial
Lifespan years16.5 years
Raunkiær life formphanerophyte
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation mean471 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formshrub
Habitat GIFTforest, meadows: dry, mountains, stony places
Leaf compoundnesssimple
Leaf shapeovate
Mycorrhiza typeectomycorrhizal
Woodinesswoody
Physiology & chemistry8
Leaf C:N ratio28.34 g/g
Leaf c450 mg/g
Leaf dry-matter content (LDMC)273 mg/g
Leaf n15.22 mg/g
Leaf p1.14 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)11.42 mm²/mg
Wood density793 mg/cm³
03Chemical composition2 compounds
Compounds documented for Cistus salviifolius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Flavan-3-ols2
Documented compounds2 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| [5,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-3-yl] 4-hydroxybenzoate | present | LOTUS | |
| Tea, ext. | present | LOTUS |
05DNA & barcoding16 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cistus salviifolius has left across the world's sequence archives.
At a glance
DNA specimens16
Marker genes4
GenBank sequences10
eDNA detections13
Countries5
The DNA barcodea real sequence read deposited for this species
CATTGTCGATTCCTGCCTAGCAGACAGACCCGCGAACTGGTTATAAACAACGCGTCGCGGCCGTCGTCGGGCGAGAGCCCCGCGACGGCC …
Cistus salviifolius voucher SRC725_FR-IT_sal internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★ITS10★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Cistus salviifolius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 327 640 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cistus salviifolius2.33 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–182n range18median18mode47records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1847×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · iber-fl +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · ita-fl — CHIARUGI A. - 1925. Embriologia delle Cistaceae.. N. Giorn. Bot. Ital., n.s. , 32: 223-314.
CCDB · ita-fl — BRULLO S., PAVONE P., ZIZZA A. - 1979. Numeri cromosomici per la flora italiana:602-616.. Inform. Bot. Ital. , 11(2): 139-147.
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · iber-fl — Chromosome numbers of some flowering plants of Spain and France. Gadella, Th., E. Kliphuis & E. A. Mennega.Acta Bot. Neerl.15(2): 484-489(1966).
CCDB · iber-fl — Chromosome numbers of some Iberian. Cistaceae. Lve, A. & E. Kjellqvist.Portugaliae Acta Biol.8: 69-80(1964).
CCDB · iber-fl — Chromosome numbers of vascular plants from Austria, Mallorca and Yugoslavia. Nilsson, O. & P. Lassen.Bot. Not.124: 270-276(1971).
CCDB · iber-fl — Contribucin al estudio cariolgico del gnero Cistus L. I Snchez Anta, M. A. & F. Gallego Martn.Stud. Bot. Univ. Salamanca4: 103-107(1985).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XIV. Cistaceae Leitao, M. T. & M. C. Alves.Bol. Soc. Brot. ser. 250: 247-263(1976).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 1-34. Valds Bermejo, E.Anales Jard. Bot. Madrid36: 373-389(1980).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · fl-europaea — LOve & Kjellquist,
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Magulaev, A. J. 1986. Chromosome numbers in some species of flowering plants of the Crimea and Caucasus floras. Bot. Zhurn. SSSR 71: 1575–1578.
CCDB · ipcn-api-dl — Sanchez Anta, M. A., F. G. Martin & F. N. Andres. 1985. Sobre la cariologia de algunas especies de Helianthemum Miller de la region Castellano-Leonesa. Stud. Bot. Univ. Salamanca 4: 165–168.
CCDB · ipcn-api-dl — Capineri, R., G. D'Amato & P. Marchi. 1978. Numeri cromosomici per la Flora Italiana. 534-583. Inform. Bot. Ital. 10: 421-465.
CCDB · ipcn-api-dl — Markova, M. 1975. Karyosystematic studies in the Cistaceae of Bulgaria. Pl. Syst. Evol. 123: 283–315.
CCDB · ipcn-api-dl — Markova, M. 1975. Karyosystematische Untersuchungen an den Cistaceae Bulgariens. Pl. Syst. Evol. 123: 283–315.
CCDB · ipcn-api-dl — Natarajan, G. 1977. Contribution à l'etude caryosystematique des especes de la garrigue languedocienne. These, Academie de Montpellier, France.
CCDB · ipcn-api-dl — Natarajan, G. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Leitao, M. T. & M. C. ALVES. 1976. Contribuicao para o conhecimento citotaxonomico das Spermatophyta de Portugal. Cistaceae. Bol. Soc. Brot., sér. 2 50: 247–263.
CCDB · book-ipcn66 — Gadella et al. 1966
CCDB · book-ipcn75-78 — Leitao & Alves 1976
CCDB · book-ipcn75-78 — Natarajan 1978
CCDB · book-ipcn75-78 — Na tarajan 1977
CCDB · book-ipcn75-78 — Markova 1975
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · book-ipcn73-74 — NILSSON, Q., & P. LASSEN. 1971. Chromosome numbers of vascular pla from Austria, Mallorca and Yugoslav1a. Bot. Not1ser 124: 270-276. I
CCDB · book-atlas-flowering-plants — Dansereau 1940
CCDB · kew — Ellul P, Boscaiu M, Vicente O, Moreno V, Rossello JA. 2002. Intra- and interspecific variation in DNA content in Cistus (Cistaceae). Annals of Botany 90: 345-351.
CCDB · CromoCat 2015 — Atsmon, D. & Feinbrun, N. (1960). Chromosome counts in Israeli Cistaceae. Caryologia 13: 240-246.
CCDB · CromoCat 2015 — Brullo, S., Pavone, P. & Zizza, A. (1979a). Numeri cromosomici per la flora italiana: 602-616. Inf. Bot. Ital. 11: 139-147.
CCDB · CromoCat 2015 — Dahlgren, R., Karlsson, Th. & Lassen, P. (1971). Studies on the Flora of the Balearic Islands, I. Chromosome numbers in Balearic Angiosperms. Bot. Not. 124(1): 249-269.
CCDB · CromoCat 2015 — Gadella, Th. W. J., Kliphuis, E. & Mennega, E. A. (1966). Chromosome numbers of some flowering plants of Spain and S France. Acta Bot. Neerl. 15(2): 484-489.
CCDB · CromoCat 2015 — Leitao, M. T. & Alves, M. C. (1976). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XIV. Cistaceae. Bol. Soc. Brot. 50: 247-263.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1964). Chromosome numbers of some Iberian. Cistaceae. Portugaliae Acta Biol., Sér. A 8: 69-80.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
+7 more references
n 912×CCDB · ita-fl · CCDB · iber-fl · CCDB · ipcn-api-dl +2
CCDB · ita-fl — CAPINERI R., D'AMATO G., MARCHI P. - 1979 (1978). Numeri cromosomici per la flora italiana:534-583.. Inform. Bot. Ital. , 10(3): 421-465.
CCDB · iber-fl — Contribucin al estudio cariolgico del gnero Cistus L. I Snchez Anta, M. A. & F. Gallego Martn.Stud. Bot. Univ. Salamanca4: 103-107(1985).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 452-465. Ruz de Clavijo Jimnez, E.Anales Jard. Bot. Madrid45(1): 259-266(1988).
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Ruíz de Clavijo Jiménez, E. 1988. Números cromosomáticos de plantas occidentales, 452--465. Anales Jard. Bot. Madrid 45: 259–266.
CCDB · ipcn-api-dl — Sanchez Anta, M. A., F. G. Martin & F. N. Andres. 1985. Sobre la cariologia de algunas especies de Helianthemum Miller de la region Castellano-Leonesa. Stud. Bot. Univ. Salamanca 4: 165–168.
CCDB · ipcn-api-dl — Ruíz de Clavijo, E. 1991. Notas cariológicas sobre algunas especies norteafricanas. Acta Bot. Malac. 16: 449–454.
CCDB · ipcn-api-dl — Natarajan, G. 1977. Contribution à l'etude caryosystematique des especes de la garrigue languedocienne. These, Academie de Montpellier, France.
CCDB · book-ipcn75-78 — Na tarajan 1977
CCDB · CromoCat 2015 — Capineri, R., D'Amato, G. & Marchi, P. (1978b). Numeri cromosomici per la flora italiana: 534-583. Inf. Bot. Ital. 10: 421-465.
CCDB · CromoCat 2015 — Ruíz de Clavijo Jiménez, E. (1988). Números cromosomáticos de plantas occidentales, 452-465. Anales Jard. Bot. Madrid 45(1): 259-266.
CCDB · CromoCat 2015 — Sánchez Anta, M. A. & F. Gallego Martín. (1985). Contribución al estudio cariológico del género Cistus L. I Stud. Bot. Univ. Salamanca 4: 103-107.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type131 563 records
Wild obs. + sensor127 788
Museum / vouchered2 622
Cultivated / captive14
Other1 139
Origin
Native3 643
Introduced13
Range
Area of Occupancy AOO116 280 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy79% within 1 km
≤100 m 74 375≤1 km 8 300≤10 km 21 497>10 km 786
104 958 georeferenced · 22 830 without coordinates
Open the mapobservation + sensor127 788
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 53≤1 km 432≤10 km 353>10 km 11
849 georeferenced · 1 773 without coordinates
Open the institutions mapphysical evidence2 622
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 2
2 georeferenced · 12 without coordinates
Open the mapnot free-living14
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions55 of 101 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 795 |
| MAlocation not on record | 188 |
| València, ES | 137 |
| ISAlocation not on record | 121 |
| Berlin, DE | 109 |
| CICYTEXlocation not on record | 99 |
| BClocation not on record | 81 |
| College of the Atlantic, Museumlocation not on record | 71 |
| LDlocation not on record | 65 |
| Vitoria, ES | 63 |
| Barcelona, ES | 57 |
| Badajoz, ES | 51 |
| BDBClocation not on record | 47 |
| Wlocation not on record | 43 |
| Jaén, ES | 42 |
| Museo Entomologico de Leonlocation not on record | 35 |
| Lausanne, CH | 31 |
| Salamanca, ES | 29 |
| Sevilla, ES | 26 |
| Bern, CH | 25 |
| CJBGlocation not on record | 24 |
| San Sebastián, ES | 22 |
| Entomological Society of Latvialocation not on record | 21 |
| UIBlocation not on record | 20 |
| Granada, ES | 19 |
| Madrid, ES | 18 |
| Córdoba, ES | 18 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 17 |
| Sevilla, ES | 17 |
| Pamplona, ES | 16 |
| BRNUlocation not on record | 15 |
| Alicante, ES | 14 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 14 |
| Museo Achille Folettolocation not on record | 13 |
| Rishon Le Zion, IL | 13 |
| Canberra, AU | 9 |
| Santiago de Compostela, ES | 9 |
| JBSlocation not on record | 9 |
| Phyletisches Museum Jenalocation not on record | 9 |
| Madrid, ES | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| Pamplona, ES | 8 |
| Dresden, DE | 6 |
| MeiseBGlocation not on record | 6 |
| GZUlocation not on record | 6 |
| Moscow State Universitylocation not on record | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 6 |
| Kew, GB | 5 |
| Auckland, NZ | 5 |
| Copenhagen, DK | 4 |
| Mount Annan, AU | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Görlitz, DE | 4 |
| Bourges, FR | 4 |
| Christchurch, NZ | 4 |
| OLAlocation not on record | 3 |
| Bloomington, US | 3 |
| WTUlocation not on record | 3 |
| Riverside, US | 3 |
| JBCLMlocation not on record | 3 |
| Henry Brockhouse Collectionlocation not on record | 3 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 3 |
| Muséum Henri Lecoqlocation not on record | 2 |
| San Diego, US | 2 |
| Uppsala, SE | 2 |
| Parkville, AU | 2 |
| Hobart, AU | 2 |
| Claremont, US | 2 |
| South Kensington, GB | 2 |
| Adelaide, AU | 2 |
| Santa Cruz, US | 2 |
| Oskarshamn, SE | 2 |
| Clocation not on record | 2 |
| Saint Louis, US | 2 |
| Banyoles, ES | 2 |
| PRClocation not on record | 1 |
| Monastir, TN | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Frankfurt am Main | 1 |
| San Francisco, US | 1 |
| Zürich, CH | 1 |
| Edinburgh, GB | 1 |
| University of Patraslocation not on record | 1 |
| Gijón, ES | 1 |
| Paris, FR | 1 |
| Stockholm, SE | 1 |
| AUAlocation not on record | 1 |
| Bronx, US | 1 |
| Flagstaff, US | 1 |
| JBAlocation not on record | 1 |
| Xiamen, CN | 1 |
| Sion, CH | 1 |
| MHNAIXlocation not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| CASlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| GJOlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
101 institutions · 2 578 of 2 622 vouchered records shown · 37 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA13 detections
Where the DNA of Cistus salviifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found13
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 13 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.2 °C 15.2–17.3
Seasonal swing summer↔winter21.1 °C
Max temp (day)20.1 °C 20.1–22.3
Min temp (night)9.00 °C 9.00–11.7
Precipitation33.4 mm/mo 33.4–57.8
Air humidity52.9 % 52.9–54.6
Moisture balance-61.7 mm/mo -61.7–-32.5
Vapour deficit953 Pa 953–972
Wind speed2.00 m/s 2.00–2.20
Cloud cover38.3 % 38.3–39.8
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.