Cistus parviflorus

Lam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Cistaceae/Cistus

At a glance

Occurrence records541

Data sources9

Biological traits17

DNA specimens5

eDNA detections5

Sources9 archives

Databases and archives Cistus parviflorus's data was compiled from.

GBIFGlobal Biodiversity Information Facility541 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF541 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT2.4 Gbp

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.9 m

Seed mass0.796 mg

Seed mass max1 mg

Seed mass min0.6 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Habitat & environment5

Aquaticterrestrial

Climatesubtropical

Growth formshrub

Mycorrhiza typeectomycorrhizal

Woodinesswoody

Physiology & chemistry4

Leaf n15.1 mg/g

Leaf p0.8 mg/g

Photosynthetic pathwayC3

Wood density790 mg/cm³

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cistus parviflorus has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences9

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSDQ092934.1 ↗643 bpGreece

ACGT

CGATTCCTGCCTAGCAGACAGACCCGCGAACTGGTTATACACACACGCGTCGCGGCCGTCGTCGGGCGAGAGCCCTGCGATGGCTCGTCG …

Cistus parviflorus voucher 6BGA04 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Cistus parviflorus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 425 440 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Cistus parviflorus2.43 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 187×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · iber-fl +4

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ita-fl — BRULLO S., PAVONE P., TERRASI M.C. - 1978. Numeri cromosomici per la flora italiana:494-505.. Inform. Bot. Ital. , 10(2): 278-290.

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · ipcn-api-dl

CCDB · book-fedorov — Dansereau 1940

CCDB · book-atlas-flowering-plants — Dansereau 1940

CCDB · kew — Ellul P, Boscaiu M, Vicente O, Moreno V, Rossello JA. 2002. Intra- and interspecific variation in DNA content in Cistus (Cistaceae). Annals of Botany 90: 345-351.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type541 records

Wild obs. + sensor449

Museum / vouchered79

Cultivated / captive1

Other12

Range

Area of Occupancy AOO1 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 223≤1 km 120≤10 km 13>10 km 17

373 georeferenced · 76 without coordinates

Open the mapobservation + sensor449

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 3≤10 km 2

5 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence79

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	46
Berlin, DE	5
BIO-UNIPIlocation not on record	4
Wlocation not on record	3
San Sebastián, ES	2
BRNUlocation not on record	2
Stockholm, SE	1
MAlocation not on record	1
Moscow State Universitylocation not on record	1
GJOlocation not on record	1
Dresden, DE	1
Saint Louis, US	1
València, ES	1
BClocation not on record	1
Bloomington, US	1

15 institutions · 71 of 79 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Cistus parviflorus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 17.0–19.9

Seasonal swing summer↔winter16.2 °C

Max temp (day)18.5 °C 18.5–25.1

Min temp (night)14.9 °C 14.0–14.9

Precipitation55.2 mm/mo 34.3–55.2

Air humidity62.8 % 53.9–62.8

Moisture balance-51.6 mm/mo -85.2–-51.6

Vapour deficit758 Pa 758–1,216

Wind speed3.00 m/s 2.40–3.00

Cloud cover38.3 % 36.9–38.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)