Cistus osbeckiifolius

Webb ex Pit. & Proust · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Cistaceae/Cistus

At a glance

Occurrence records48

Data sources7

Biological traits23

DNA specimens10

eDNA detections20

Sources7 archives

Databases and archives Cistus osbeckiifolius's data was compiled from.

GBIFGlobal Biodiversity Information Facility48 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF48 records

Environmental DNA1 datasets · 1 countries20 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 18

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Inflorescence length max30 cm

Inflorescence length min12 cm

Leaf length max80 mm

Leaf length min25 mm

Leaf width max35 mm

Plant height max4 m

Plant height min0.5 m

Seed mass0.493 mg

Life cycle & reproduction8

Dehiscencedehiscent

Flower colourpink

Flower length max3 mm

Flower length min2 mm

Flowering endJun

Flowering startApr

Life formshrub

Life spanperennial

Habitat & environment7

Climatesubtropical

Elevation max2 300 m

Elevation min1 600 m

Fruit typecapsule

Growth formshrub

Leaf formelliptic

Woodinesswoody

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cistus osbeckiifolius has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences10

eDNA detections20

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ281663.1 ↗643 bpSpain

ACGT

CGATTCCTGCCTAGCAGACAGACCCGCGAACTGGTTATACACAACGCGCCGCGGCCGGTGTCGGGCGAGAGCCCCGCAGCGGCCCGGCGC …

Cistus osbeckiifolius internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL2★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cistus osbeckiifolius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · kew

CCDB · kew — Ellul P, Boscaiu M, Vicente O, Moreno V, Rossello JA. 2002. Intra- and interspecific variation in DNA content in Cistus (Cistaceae). Annals of Botany 90: 345-351.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type48 records

Wild obs. + sensor37

Museum / vouchered11

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy16% within 1 km

≤100 m 2≤1 km 4≤10 km 31

37 georeferenced

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
MAlocation not on record	1

1 institutions · 1 of 11 vouchered records shown

09Environmental DNA20 detections

Where the DNA of Cistus osbeckiifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C

Min temp (night)9.00 °C

Precipitation33.4 mm/mo

Air humidity52.9 %

Moisture balance-61.7 mm/mo

Vapour deficit953 Pa

Wind speed2.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)