Cistus libanotis

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Cistaceae/Cistus

At a glance

Occurrence records1 536

Data sources9

Biological traits15

DNA specimens6

eDNA detections6

Sources9 archives

Databases and archives Cistus libanotis's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 536 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF1 536 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB · GoaT2.8 Gbp

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.95 m

Seed mass0.821 mg

⚠ sources differ — TRY: 0.821 mg · GIFT: 24.28 mg

Seed mass max24.28 mg

Seed mass min24.28 mg

Life cycle & reproduction4

Deciduousnessevergreen

Dispersal typeunspecialized

Life formshrub

Life spanperennial

Habitat & environment4

Climatesubtropical

Fruit fleshinessdry

Growth formshrub

Woodinesswoody

Physiology & chemistry3

Leaf n15.1 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)3.69 mm²/mg

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cistus libanotis has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences6

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ092948.1 ↗647 bpSpain

ACGT

CGATTCCTGCCTAGCAGACAGACCCGCGAACTGGTTATACACAACGCGCCGCGGCCGTCGTCGGGCGAGAGCCCCGCAGCGGCCCCGCGC …

Cistus libanotis voucher 149BGA04 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Cistus libanotis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 821 530 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Cistus libanotis2.82 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 186×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · ipcn-api-dl +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 1-34. Valds Bermejo, E.Anales Jard. Bot. Madrid36: 373-389(1980).

CCDB · ipcn-api-dl — Valdes-Bermejo, E. 1980. Numeros cromosomaticos de plantas occidentales. 1-34. Anales Jard. Bot. Madrid 36: 373–389.

CCDB · book-fedorov — Dansereau 1940

CCDB · kew — Ellul P, Boscaiu M, Vicente O, Moreno V, Rossello JA. 2002. Intra- and interspecific variation in DNA content in Cistus (Cistaceae). Annals of Botany 90: 345-351.

CCDB · CromoCat 2015 — Valdés Bermejo, E. (1980a). Números cromosomáticos de plantas occidentales, 1-34. Anales Jard. Bot. Madrid 36: 373-389.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 536 records

Wild obs. + sensor1 430

Museum / vouchered106

Range

Area of Occupancy AOO1 332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 198≤1 km 9≤10 km 160>10 km 1

1 368 georeferenced · 62 without coordinates

Open the mapobservation + sensor1 430

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 2≤1 km 25≤10 km 19>10 km 1

47 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BClocation not on record	21
MAlocation not on record	17
College of the Atlantic, Museumlocation not on record	9
ISAlocation not on record	8
CICYTEXlocation not on record	7
Wlocation not on record	6
Barcelona, ES	3
Museo Achille Folettolocation not on record	3
San Jose State University, Museum of Birds and Mammalslocation not on record	3
Sevilla, ES	3
Alicante, ES	2
València, ES	2
Vitoria, ES	2
Madrid, ES	2
Salamanca, ES	1
Kew, GB	1
Granada, ES	1
JBCLMlocation not on record	1

18 institutions · 92 of 106 vouchered records shown · 10 without an institution code

09Environmental DNA6 detections

Where the DNA of Cistus libanotis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–18.3

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C 20.1–23.2

Min temp (night)9.00 °C 9.00–12.8

Precipitation33.4 mm/mo 33.4–65.8

Air humidity52.9 % 52.9–54.9

Moisture balance-61.7 mm/mo -61.7–-25.8

Vapour deficit953 Pa 953–993

Wind speed2.00 m/s 2.00–2.40

Cloud cover38.3 % 38.3–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cistus libanotis

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction4

Habitat & environment4

Physiology & chemistry3

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 536 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 536 records