Cistanche tubulosa

(Schenk) Wight · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Cistanche

At a glance

Occurrence records913

Data sources11

Biological traits19

DNA specimens29

eDNA detections19

Sources11 archives

Databases and archives Cistanche tubulosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility913 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS · NPASS161 compounds

Occurrence & distributionGBIF913 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD · NCBI29 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Cistanche tubulosa (Schenk) Wight – gatunek rośliny należący do rodziny zarazowatych (Orobanchaceae). Występuje w Afryce Północnej i Azji Zachodniej

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.15 m

Plant height max1 m

Plant height min0.3 m

Seed mass0.07 mg

Seed mass max0.07 mg

Seed mass min0.07 mg

Life cycle & reproduction5

Flowering endApr

Flowering startMar

Life formholoparasitic perennial

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteobligatory

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTParasitic on species of Tamarix L. Mainly in river and lake valleys in sandy and pebbly soil

Woodinessnon-woody

03Chemical composition161 compounds

Compounds documented for Cistanche tubulosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives $ Phenylethanoids72

Iridoids monoterpenoids36

Cinnamic acids and derivatives11

Acyclic monoterpenoids9

Furofuranoid lignans9

Documented compounds161 total

Tissue Source Quantified only

Compound	Amount	Source
((2R,3R,4R,5R,6R)-6-(2-(3,4-dihydroxyphenyl)ethoxy)-5-hydroxy-2-(((2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxymethyl)-4-((2R,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl)oxyoxan-3-yl) (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS
(+)-7-epi-Syringaresinol 4'-glucoside	present	LOTUS
(+)-Syringaresinol	present	NPASS
(+)-syringaresinol beta-D-glucoside	present	LOTUS
(+)-Ursolic Acid	present	NPASS
(-)-Syringaresinol	present	NPASS
(1R,3aR,5aR,5bR,7aR,11R,11aS,11bS,12R,13aR,13bR)-11,12-dihydroxy-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-2,3,4,5,6,7,7a,10,11,11b,12,13,13a,13b-tetradecahydro-1H-cyclopenta[a]chrysen-9-one	present	NPASS
(1R,3aR,5aR,5bR,7aS,9S,11R,11aS,11bS,12R,13aR,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-9,11,12-triol	present	NPASS
(1R,4aR,7R,7aR)-7-hydroxy-7-methyl-1-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-4-carboxylic acid	present	LOTUS
(1S,4aS,6S,7S,7aR)-6-hydroxy-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylic acid	present	LOTUS

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cistanche tubulosa has left across the world's sequence archives.

At a glance

DNA specimens29

Marker genes4

GenBank sequences10

eDNA detections19

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPP035440.1 ↗233 bp

ACGT

CGCATCGTGTTGCCCCCTCCTCTGTCCTTCTGGGACAATGCTTAGGTGGGGGCGGATAATGGCCTCCCGTTCGTCATGACGTGCGGTTGG …

Cistanche tubulosa voucher ABRCP476024 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cistanche tubulosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records40–402n range40median40mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 403×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · Cave1956

CCDB · book-indian_vol1 — Hambler, D.J. 1956, 1958

CCDB · book-fedorov — Hambler 1956, 1958b

CCDB · Cave1956 — Hambler

n 202×CCDB · iber-fl

CCDB · iber-fl — Estudios cariolgicos sobre la flora espaola. Fernndez Casas, J. & al.Bol. Soc. Brot. ser. 248: 99-105(1974).

CCDB · iber-fl — IOPB. Chromosome number reports. LXXI. Palomeque, T. & A. Saudo.Taxon30(2): 507-508(1981).

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type913 records

Wild obs. + sensor856

Museum / vouchered57

Range

Area of Occupancy AOO2 084 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 194≤1 km 71≤10 km 80>10 km 29

374 georeferenced · 482 without coordinates

Open the mapobservation + sensor856

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	16
Edinburgh, GB	8
Sharjah Research Academy, Seed Bank and Herbariumlocation not on record	4
South Kensington, GB	4
Sharjah Seed Bank & Herbariumlocation not on record	3
Beijing, CN	2
Rishon Le Zion, IL	2
Canadian Department of Agriculturelocation not on record	2
Uppsala, SE	2
Dehra Dun, IN	2
TAFORI-LSRClocation not on record	1
Tampa, US	1
Moscow State Universitylocation not on record	1
Wlocation not on record	1
Frankfurt am Main	1

15 institutions · 50 of 57 vouchered records shown · 5 without an institution code

09Environmental DNA19 detections

Where the DNA of Cistanche tubulosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.0 °C 19.5–22.8

Seasonal swing summer↔winter15.3 °C

Max temp (day)25.6 °C 23.5–26.7

Min temp (night)15.3 °C 12.5–19.1

Precipitation27.6 mm/mo 5.20–35.1

Air humidity56.2 % 47.5–57.2

Moisture balance-92.8 mm/mo

Vapour deficit1,213 Pa 976–1,365

Wind speed3.80 m/s

Cloud cover22.8 % 18.2–23.6

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)