Cissus verticillata
(L.) Nicolson & C.E.Jarvis · speciesAt a glance
Occurrence records6 885
Data sources15
Biological traits22
DNA specimens22
eDNA detections9
Sources15 archives
Databases and archives Cissus verticillata's data was compiled from.
WikipediaWikimedia Foundation7 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility6 836 records↗
OBISOcean Biodiversity Information System49 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics22 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources22 traits
Chemical compositionDukesPhytochem · LOTUS21 compounds
Occurrence & distributionGBIF · OBIS6 885 records
Environmental DNA1 datasets · 1 countries9 detections
DNA & barcodingBOLD · NCBI22 specimens
Genome at a glanceCCDB2n = 48
01Narrative
Cissus verticillata, the princess vine or seasonvine, is an evergreen perennial vine in the grapevine family Vitaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology7
Plant height20 m
Seed mass30.97 mg
Seed mass max52.67 mg
Seed mass min18.1 mg
Seed volume39 mm³
Seed volume max39 mm³
Seed volume min39 mm³
Life cycle & reproduction3
Deciduousnessevergreen
Life formliana
Life spanperennial
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatewet tropical
Climberobligatory
Elevation max2 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Growth formshrub
⚠ sources differ — GIFT: shrub · TRY: Vine
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta de Igapó, Floresta de Terra Firme, Floresta de Várzea, Floresta Estacional Decidual, Floresta Estacional Perenifólia, Floresta Estacional Semidecidual, Fl
Woodinesswoody
Physiology & chemistry1
Nitrogen fixingnon_nitrogen_fixer
03Chemical composition21 compounds
Compounds documented for Cissus verticillata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols12
Anthocyanidins3
Pterocarpan2
Chalcones1
Furofuranoid lignans1
Documented compounds21 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Pinoresinol | present | LOTUS | |
| (E)-3-methoxy-1-(4-methoxy-1-benzofuran-5-yl)-3-phenylprop-2-en-1-one | present | LOTUS | |
| 3-[(2S,3R,4R,5S)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-2-(3,4-dihydroxyphenyl)-5-hydroxy-7-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-4-one | present | LOTUS | |
| [(2S,3R,4R,5S)-3,4-dihydroxy-5-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxo-7-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-3-yl]oxyoxolan-2-yl]methyl acetate | present | LOTUS | |
| [(2S,3R,4R,5S)-5-[2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxo-7-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-3-yl]oxy-3,4-dihydroxyoxolan-2-yl]methyl acetate | present | LOTUS | |
| Avicularin | present | LOTUS | |
| Cyanidin 3-arabinoside cation | present | LOTUS | |
| FLAVONOIDS | present | DukesPhytochem | |
| Guaijaverin | present | LOTUS | |
| Homopterocarpin | present | LOTUS |
05DNA & barcoding22 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cissus verticillata has left across the world's sequence archives.
At a glance
DNA specimens22
Marker genes10
GenBank sequences10
eDNA detections9
Countries4
The DNA barcodea real sequence read deposited for this species
TTTTGTTGGATTCAAAGCCGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATGAGACCAAACCTACTGATATCTTGGCAGC …
Cissus verticillata voucher DB0215 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK7★rbcL3★rbcLa★ITS★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Cissus verticillata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Ploidypolyploid inferred
Chromosome records24–482n range48median48mode5records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 484×CCDB · croinout · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · croinout — Elena, P. 1967
CCDB · croinout — Petria, E. 1973
CCDB · ipcn-api-dl — Petria, E. 1973. Macrosporogenesis, development of female gametophyte and beginning embryo differentiation in some members of the families Vitaceae and Leeaceae, followed by some phylogenetic remarks. Lucr. Grăd. Bot Bucures|7ti 1972–1973: 285–352.
CCDB · book-ipcn67-71 — ELENA, P. 1967. Cercetariacariologice la un11 representanti ai familiei Vitaceae. Acta Bot. Hort. Bucurestensis. 1966. 27-36.
2n 241×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — ELENA, P. 1967. Cercetariacariologice la un11 representanti ai familiei Vitaceae. Acta Bot. Hort. Bucurestensis. 1966. 27-36.
n 121×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Patil, V. P., M. S. Kumbhojkar & A. S. Jadhav. 1980. Chromosome numbers in the family Vitaceae. Curr. Sci. 49: 37–38.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~4.93 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin4.93 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type6 885 records
Wild obs. + sensor2 931
Museum / vouchered3 923
Cultivated / captive4
Other27
Origin
Native1 042
Range
Area of Occupancy AOO15 840 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy89% within 1 km
≤100 m 1 573≤1 km 245≤10 km 117>10 km 107
2 042 georeferenced · 889 without coordinates
Open the mapobservation + sensor2 931
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy73% within 1 km
≤100 m 293≤1 km 50≤10 km 91>10 km 34
468 georeferenced · 3 455 without coordinates
Open the institutions mapphysical evidence3 923
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 1
1 georeferenced · 3 without coordinates
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions88 of 225 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| National Biodiversity Institute, Costa Ricalocation not on record | 291 |
| UNESP-RClocation not on record | 274 |
| Chicago, US | 239 |
| University of Stellenboschlocation not on record | 222 |
| Bronx, US | 200 |
| San Isidro, AR | 188 |
| Saint Louis, US | 146 |
| Durango, MX | 126 |
| Mérida, MX | 115 |
| UFMGlocation not on record | 109 |
| Tampa, US | 71 |
| Salvador, BR | 51 |
| Puerto Ayora, EC | 49 |
| Riverside, US | 46 |
| Laboratorio de Ictiologialocation not on record | 42 |
| Durham, US | 41 |
| Blumenau, BR | 40 |
| Mexico City, MX | 39 |
| UFMSlocation not on record | 38 |
| Chaguaramas, TT | 32 |
| Cenargenlocation not on record | 30 |
| JBRJlocation not on record | 30 |
| Corrientes, AR | 28 |
| USP-IBlocation not on record | 28 |
| Brasília, BR | 27 |
| Kew, GB | 26 |
| UFBAlocation not on record | 26 |
| INMAlocation not on record | 25 |
| Berlin, DE | 25 |
| Xiamen, CN | 24 |
| Antiguo Cuscatlán, SV | 24 |
| Campo Mourão, BR | 23 |
| Miami, US | 23 |
| UNICAMPlocation not on record | 23 |
| Departamento de Sistematica e Ecologialocation not on record | 23 |
| Universidad Industrial de Santander (UIS)location not on record | 23 |
| UTFPR-CPlocation not on record | 23 |
| Istituto Agrario Castelnuovolocation not on record | 23 |
| South Kensington, GB | 22 |
| Masindi, UG | 21 |
| UnBlocation not on record | 21 |
| Universidad de Nariño (UdeNar)location not on record | 21 |
| Uberlândia, BR | 20 |
| UFPElocation not on record | 20 |
| CEPLAClocation not on record | 20 |
| Universidad Nacional de Colombia (UNAL)location not on record | 19 |
| Autlán de Navarro, MX | 19 |
| Ivano-Frankivsk, UA | 19 |
| Feira de Santana, BR | 18 |
| ESALQlocation not on record | 18 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 18 |
| Juriquilla, MX | 16 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 15 |
| Anchorage, US | 15 |
| UFRPElocation not on record | 15 |
| Altos de Pipe, VE | 14 |
| UFESlocation not on record | 14 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 14 |
| Universidade de São Paulolocation not on record | 14 |
| Stockholm, SE | 14 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 13 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 12 |
| Brasília, BR | 12 |
| Museu Paraense Emílio Goeldilocation not on record | 12 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 12 |
| Universidade Federale do Rio Grande do Sullocation not on record | 11 |
| La Paz, BO | 11 |
| Universidade Federal do Maranhãolocation not on record | 10 |
| Universidade Estadual Paulistalocation not on record | 10 |
| Aarhus, DK | 10 |
| UNIVASFlocation not on record | 9 |
| MEXUlocation not on record | 9 |
| ASUlocation not on record | 8 |
| IPA/SPlocation not on record | 8 |
| Loja, EC | 8 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 8 |
| Santa Cruz de la Sierra, BO | 8 |
| UEPAlocation not on record | 7 |
| Bloomington, US | 7 |
| Federal University of Espírito Santolocation not on record | 7 |
| Paris, FR | 7 |
| San José, CR | 7 |
| UFSClocation not on record | 6 |
| UEMlocation not on record | 6 |
| MAlocation not on record | 6 |
| Universidade Federal de Goiáslocation not on record | 6 |
| Fortaleza, BR | 6 |
| Londrina, BR | 6 |
| Chongqing Museumlocation not on record | 6 |
| Wuzhou, CN | 5 |
| Cascavel, BR | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 5 |
| UFERSAlocation not on record | 5 |
| HACAMlocation not on record | 5 |
| UFSCarlocation not on record | 5 |
| UFOPlocation not on record | 5 |
| Toluca, MX | 5 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 5 |
| UTFPR-DVlocation not on record | 5 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 5 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 5 |
| Nishihara, JP | 5 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 4 |
| Maringá, BR | 4 |
| Universidade Federal de Santa Catarinalocation not on record | 4 |
| Fort Worth, US | 4 |
| Université de Bordeauxlocation not on record | 4 |
| UNESP-ISlocation not on record | 4 |
| Foz do Iguaçu, BR | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| EL PASO, US | 4 |
| FUVATESlocation not on record | 4 |
| UNESP, Campus São José Rio Prêtolocation not on record | 4 |
| Montréal, CA | 4 |
| Glocation not on record | 4 |
| San Diego, US | 3 |
| UNESP-FCAlocation not on record | 3 |
| Quito, EC | 3 |
| Wlocation not on record | 3 |
| URCAlocation not on record | 3 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Fredericksburg, US | 3 |
| Honolulu, US | 3 |
| UNESClocation not on record | 3 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 3 |
| IECOSlocation not on record | 3 |
| HUENFlocation not on record | 3 |
| Ilhéus, BR | 3 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 3 |
| Criciúma, BR | 3 |
| San Francisco de Campeche, MX | 3 |
| UESBlocation not on record | 3 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 3 |
| Davis, US | 3 |
| UTFPR-SLlocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 3 |
| OTSlocation not on record | 3 |
| Mazatlán, MX | 3 |
| CASlocation not on record | 2 |
| UFRRJlocation not on record | 2 |
| Santiago de Cali, CO | 2 |
| Córdoba, AR | 2 |
| Frankfurt am Main | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 2 |
| Castelar, AR | 2 |
| Beijing, CN | 2 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 2 |
| HEMlocation not on record | 2 |
| Universidad Nacional de Misiones- CONICETlocation not on record | 2 |
| Universidad Nacional de Asunciónlocation not on record | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| Auckland, NZ | 2 |
| Lake Charles, US | 2 |
| Toronto, CA | 2 |
| Barcelona, ES | 2 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 2 |
| Göteborg, SE | 2 |
| Provincia di Livornolocation not on record | 2 |
| UNESP-FCAVlocation not on record | 1 |
| JBPlocation not on record | 1 |
| Cambridge, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Moscow, US | 1 |
| MeiseBGlocation not on record | 1 |
| HUAlocation not on record | 1 |
| Santarém, BR | 1 |
| Universidade Federal de Minas Geraislocation not on record | 1 |
| UFPIlocation not on record | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Jataí / Setor Industrial, BR | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| Madison, US | 1 |
| Badajoz, ES | 1 |
| Calabar, NG | 1 |
| Cruz das Almas, BR | 1 |
| Corporación Universitaria Santa Rosa de Cabal (UNISARC)location not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| HAWlocation not on record | 1 |
| FAVElocation not on record | 1 |
| Seropédica, BR | 1 |
| NHMJlocation not on record | 1 |
| Fundación Estación Biológica Guayacanallocation not on record | 1 |
| Paleontological Collectionlocation not on record | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| CPATSAlocation not on record | 1 |
| UNISANTAlocation not on record | 1 |
| Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record | 1 |
| Claremont, US | 1 |
| UNESP-IBILCElocation not on record | 1 |
| UFSJlocation not on record | 1 |
| Clocation not on record | 1 |
| PUC-RSlocation not on record | 1 |
| UFABClocation not on record | 1 |
| NAlocation not on record | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Chapel Hill, US | 1 |
| Tapachula, MX | 1 |
| UFVJMlocation not on record | 1 |
| Universidad de Córdoba (UC)location not on record | 1 |
| Austin, US | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| Taipei, TW | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Universidad del Tolima (UT)location not on record | 1 |
| BMlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Llocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Guasave, MX | 1 |
| Chapingo, MX | 1 |
| UTPLlocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 1 |
| BISHlocation not on record | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| UFPRlocation not on record | 1 |
225 institutions · 3 751 of 3 923 vouchered records shown · 123 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA9 detections
Where the DNA of Cissus verticillata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found9
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 9 detections have coordinates
Open the map1 country0
Campo rupestre de canga.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median27.6 °C 27.6–27.6
Seasonal swing summer↔winter5.50 °C
Max temp (day)33.1 °C
Min temp (night)23.5 °C
Precipitation149 mm/mo
Air humidity63.1 %
Moisture balance-12.1 mm/mo
Vapour deficit1,363 Pa
Wind speed1.50 m/s
Cloud cover30.1 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.