Cissus rotundifolia

(Forssk.) Vahl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Vitales/Vitaceae/Cissus

At a glance

Occurrence records632

Data sources10

Biological traits15

DNA specimens19

eDNA detections9

Sources10 archives

Databases and archives Cissus rotundifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility632 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources15 traits

Chemical compositionNPASS7 compounds

Occurrence & distributionGBIF632 records

Environmental DNA1 datasets · 4 countries9 detections

DNA & barcodingBOLD · NCBI19 specimens

Genome at a glanceGoaT372 Mbp

01Narrative

الغلف هو جنس نباتات متسلقة ينتمي للفصيلة الكرمية. يسمى أيضاً الحلص في أرض اليمن، ينتشر الغلف في جنوب جزيرة العرب، وأرض اليمن، وفي شرق أفريقيا، حيث ينتشر في الأماكن الدافئة وفي سفوح الجبال وبطون والوديان.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology4

Plant height8 m

Seed mass85.9 mg

Seed mass max138 mg

Seed mass min7 mg

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberobligatory

Elevation max350 m

Elevation min50 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Habitat GIFTdry bushland, coastal bushland, riverine woodland, dry forest edges

Woodinesswoody

03Chemical composition7 compounds

Compounds documented for Cissus rotundifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Cinnamic acids and derivatives2

Flavones1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
4'-O-beta-D-glucosyl-cis-p-coumaric acid	present	NPASS
BBUDILRMCLBZGM-BYODPTDPSA-N	present	NPASS
hinokinin	present	NPASS
LXZBDLMRSNTLOR-XRVIEYGTSA-N	present	NPASS
Meloside	present	NPASS
QQDLIDKRJBFACZ-BYODPTDPSA-N	present	NPASS
ZTPPKAUYDONSLR-AYWFJNOKSA-N	present	NPASS

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cissus rotundifolia has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes7

GenBank sequences9

eDNA detections9

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMH547543.1 ↗479 bpSaudi Arabia · 2017

ACGT

ATGCGATAACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCACTAGGCTGAAGGCACG …

Cissus rotundifolia isolate UQU ALP195 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★rbcLa★trnL★trnL-F★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceGoaT

The complete instruction manual Cissus rotundifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size371 640 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Cissus rotundifolia0.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type632 records

Wild obs. + sensor473

Museum / vouchered159

Origin

Introduced1

Range

Area of Occupancy AOO1 556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 224≤1 km 38≤10 km 18>10 km 70

350 georeferenced · 123 without coordinates

Open the mapobservation + sensor473

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 5≤1 km 7≤10 km 1

13 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence159

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	14
University of Stellenboschlocation not on record	9
Instituto de Investigação Científica Tropicallocation not on record	6
Uppsala, SE	6
Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record	4
Honolulu, US	4
Durban, ZA	3
BISHlocation not on record	3
Uniwersytet Śląski w Katowicachlocation not on record	3
Berlin, DE	3
Stockholm, SE	2
Pretoria, ZA	2
University of Hargeisalocation not on record	2
Frankfurt am Main	2
Chongqing Museumlocation not on record	2
Moscow State Universitylocation not on record	2
Antiguo Cuscatlán, SV	2
CJBGlocation not on record	1
TAFORI-LSRClocation not on record	1
Dekalb, US	1
MAlocation not on record	1
Saint Louis, US	1
Seychelles National Herbariumlocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1
National Herbarium & Botanic Gardens of Malawilocation not on record	1
Claremont, US	1
Bronx, US	1

28 institutions · 80 of 159 vouchered records shown · 79 without an institution code

09Environmental DNA9 detections

Where the DNA of Cissus rotundifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map4 countries0

Deciduous woodland/Termitaria pan matrix

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 20.5–28.6

Seasonal swing summer↔winter2.60 °C

Max temp (day)26.2 °C 26.2–34.9

Min temp (night)14.5 °C 14.5–21.9

Precipitation112 mm/mo 10.1–112

Air humidity58.9 % 50.7–58.9

Moisture balance-34.2 mm/mo -153–-34.2

Vapour deficit987 Pa 987–1,866

Wind speed2.40 m/s 2.40–4.10

Cloud cover46.4 % 13.6–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)