Cissampelos pareira
speciesAt a glance
Occurrence records5 454
Data sources15
Biological traits36
DNA specimens39
eDNA detections25
Sources15 archives
Databases and archives Cissampelos pareira's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 454 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics39 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources36 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS89 compounds
Occurrence & distributionGBIF5 454 records
Environmental DNA1 datasets · 4 countries25 detections
DNA & barcodingBOLD · NCBI39 specimens
Genome at a glanceCCDB2n = 24
01Narrative
Fruits of Cissampelos pareira during the month of October Cissampelos pareira (velvetleaf) is a species of flowering plant in the family Menispermaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPTRYAusTraitsGIFT
Size & morphology10
Fruit length6 mm
Fruit width6 mm
Plant height2 m
Seed length4.5 mm
Seed mass5.99 mg
⚠ sources differ — TRY: 5.99 mg · AusTraits: 10.5 mg · GIFT: 5.99 mg
Seed mass max5.99 mg
Seed mass min5.99 mg
Seed volume18 mm³
Seed volume max18 mm³
Seed volume min18 mm³
Life cycle & reproduction11
Deciduousnessevergreen
Dispersal typeanimal
Flowering endSep
Flowering startApr
Flowering timeyyyyynnnnnyy
Life formliana
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formphanerophyte
Sex typedioecious
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatewet tropical
Climberobligatory
Elevation max2 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typedrupe
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: climber_herbaceous · TRY: Vine
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campinarana, Campo de Várzea, Campo Limpo, Campo Rupestre, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta de Igapó, Floresta de Terra Firme, Floresta de Várzea, Floresta Estacional Decidual, Floresta E
Woodinesswoody
Physiology & chemistry3
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)18.98 mm²/mg
03Chemical composition89 compounds
Compounds documented for Cissampelos pareira across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
💊 Medicinal use documented
Compound class profile5 classes
Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids14
Aporphine alkaloids $ Isoquinoline alkaloids13
Isoquinoline alkaloids5
Aporphine alkaloids4
Isoquinoline alkaloids $ Protoberberine alkaloids3
Documented compounds89 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| ALKALOIDS | 18,000 ppm | DukesPhytochem | |
| PELOSINE | 5,000 ppm | DukesPhytochem | |
| BEBEERINE | 5,000 ppm | DukesPhytochem | |
| HAYATINE | 2,500 ppm | DukesPhytochem | |
| EO | 2,000 ppm | DukesPhytochem |
05DNA & barcoding39 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cissampelos pareira has left across the world's sequence archives.
At a glance
DNA specimens39
Marker genes7
GenBank sequences10
eDNA detections25
Countries5
The DNA barcodea real sequence read deposited for this species
TTAAAGATTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATACGCTAGCAGCATTCCGAGTAACTCCTCAACCTG …
Cissampelos pareira ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL5★rbcLa★ITS★ITS2matRtrnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Cissampelos pareira carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidydiploid inferred
Chromosome records24–242n range24median24mode2records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 242×CCDB · book-indian_vol1 · CCDB · Cave1958
CCDB · book-indian_vol1 — Sinha, R. 1968 ; Malia, S.B;, Bhatta- rai, S. et al. 1977a ; Sobha, V. & Ramchandran, K. 1979
CCDB · Cave1958 — Mathew 1958c
n 126×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · Cave1958
CCDB · ipcn-api-dl — Bir, S. S. & H. Thakur. 1984. SOCGI plant chromosome number reports -- II. J. Cytol. Genet. 19: 114–115.
CCDB · ipcn-api-dl — Sidhu, M., S. S. Bir & P. Lata. 1983. In IOPB chromosome number reports LXXIX. Taxon 32: 322.
CCDB · ipcn-api-dl — Bir, S. S., H. K. Thakur & G. S. Chatha. 1987. Chromosomal studies in certain members of Ranunculaceae and Mensipermaceae. Proc. Indian Sci. Congr. Assoc. 74(3,VI): 184–185.
CCDB · ipcn-api-dl — Sobha, V. I. K. R. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 269.
CCDB · book-ipcn75-78 — Malla et al. l 977a
CCDB · Cave1958 — Mathew 1958c
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
07Deep time~6.8 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin6.8 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type5 454 records
Wild obs. + sensor695
Museum / vouchered4 747
Other12
Origin
Native276
Introduced29
Range
Area of Occupancy AOO12 244 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy46% within 1 km
≤100 m 193≤1 km 50≤10 km 175>10 km 105
523 georeferenced · 172 without coordinates
Open the mapobservation + sensor695
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy84% within 1 km
≤100 m 850≤1 km 131≤10 km 119>10 km 63
1 163 georeferenced · 3 584 without coordinates
Open the institutions mapphysical evidence4 747
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions119 of 262 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 947 |
| Durango, MX | 562 |
| Mexico City, MX | 211 |
| Bronx, US | 207 |
| National Biodiversity Institute, Costa Ricalocation not on record | 177 |
| University of Stellenboschlocation not on record | 121 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 115 |
| Mérida, MX | 108 |
| Kew, GB | 92 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 83 |
| Antiguo Cuscatlán, SV | 66 |
| Tapachula, MX | 65 |
| MEXUlocation not on record | 60 |
| Baroda, IN | 51 |
| Berlin, DE | 49 |
| Museo Entomologico de Leonlocation not on record | 45 |
| León, NI | 45 |
| Puerto Ayora, EC | 41 |
| Paleontological Collectionlocation not on record | 41 |
| Corrientes, AR | 36 |
| San Isidro, AR | 35 |
| UFMSlocation not on record | 35 |
| CASlocation not on record | 34 |
| San José, CR | 34 |
| Plocation not on record | 30 |
| Kathmandu, NP | 29 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 28 |
| Laboratorio de Ictiologialocation not on record | 28 |
| Córdoba, AR | 27 |
| St. Augustine, TT | 27 |
| South Kensington, GB | 25 |
| Blumenau, BR | 24 |
| Universidad Nacional de Colombia (UNAL)location not on record | 23 |
| Tuxtla Gutiérrez, MX | 23 |
| Autlán de Navarro, MX | 22 |
| Tampa, US | 22 |
| Chongqing Museumlocation not on record | 22 |
| San Francisco de Campeche, MX | 20 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 18 |
| Tuxtla Gutiérrez, MX | 16 |
| Santa Cruz de la Sierra, BO | 16 |
| UnBlocation not on record | 15 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 15 |
| JBRJlocation not on record | 14 |
| Altos de Pipe, VE | 14 |
| Chapingo, MX | 14 |
| Feira de Santana, BR | 14 |
| ASUlocation not on record | 13 |
| UNICAMPlocation not on record | 13 |
| Austin, US | 13 |
| Paris, FR | 13 |
| Culiacán, MX | 13 |
| Chicago, US | 12 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 12 |
| Universidade Federale do Rio Grande do Sullocation not on record | 12 |
| Cenargenlocation not on record | 12 |
| UTFPR-CPlocation not on record | 11 |
| Juriquilla, MX | 11 |
| WAGlocation not on record | 11 |
| Xiamen, CN | 11 |
| UNESP-ISlocation not on record | 10 |
| Riverside, US | 10 |
| Campo Mourão, BR | 10 |
| Stockholm, SE | 10 |
| USP-IBlocation not on record | 9 |
| Glocation not on record | 9 |
| Salvador, BR | 9 |
| La Paz, BO | 9 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 9 |
| MeiseBGlocation not on record | 8 |
| Beijing, CN | 8 |
| CJBGlocation not on record | 8 |
| Mérida, MX | 8 |
| UNESP-IBILCElocation not on record | 8 |
| Mexico City, MX | 8 |
| Guatemala City, GT | 8 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 7 |
| Brasília, BR | 7 |
| HUAlocation not on record | 7 |
| Puebla, MX | 7 |
| Dehra Dun, IN | 7 |
| Cusco, PE | 7 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 7 |
| Brasília, BR | 7 |
| UFBAlocation not on record | 7 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 6 |
| Giardini Botanici Hanburylocation not on record | 6 |
| Museu Paraense Emílio Goeldilocation not on record | 6 |
| Addis Ababa, ET | 6 |
| Moscow State Universitylocation not on record | 6 |
| Area de Conservacion Guanacastelocation not on record | 6 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| HUT Culture Collectionlocation not on record | 5 |
| FUVATESlocation not on record | 5 |
| NO DISPONIBLElocation not on record | 5 |
| Universidad de La Salle (La Salle)location not on record | 5 |
| Universidad de Antioquia (UdeA)location not on record | 5 |
| Pondicherry, IN | 5 |
| UEMlocation not on record | 5 |
| ESALQlocation not on record | 5 |
| Sucre, BO | 5 |
| Bloomington, US | 5 |
| Universiti Sains Malaysialocation not on record | 5 |
| COLlocation not on record | 5 |
| Mexico City, MX | 5 |
| Loja, EC | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| Universidad de Caldas (UCaldas)location not on record | 5 |
| Ciudad de México, MX | 4 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 4 |
| San Francisco, US | 4 |
| EL PASO, US | 4 |
| Uppsala, SE | 4 |
| UNESP-FCAlocation not on record | 4 |
| Lake Charles, US | 4 |
| Pelotas, BR | 4 |
| PUC-RSlocation not on record | 4 |
| Miami, US | 4 |
| Universidad Nacional de Asunciónlocation not on record | 4 |
| Clocation not on record | 4 |
| MAlocation not on record | 4 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 4 |
| Wlocation not on record | 4 |
| San Diego, US | 4 |
| Canberra, AU | 3 |
| FTlocation not on record | 3 |
| Cambridge, US | 3 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 3 |
| Kunming, CN | 3 |
| Ivano-Frankivsk, UA | 3 |
| EAlocation not on record | 3 |
| Taipei, TW | 3 |
| Masindi, UG | 3 |
| UFSClocation not on record | 3 |
| UNESP-RClocation not on record | 3 |
| Cambridge University Herbariumlocation not on record | 3 |
| Haramaya Universitylocation not on record | 3 |
| BMlocation not on record | 3 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 3 |
| Universidade de São Paulolocation not on record | 3 |
| QCNElocation not on record | 3 |
| Cochabamba, BO | 3 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 3 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 3 |
| University of Oxfordlocation not on record | 3 |
| Auckland, NZ | 3 |
| Xining, CN | 3 |
| Aarhus, DK | 3 |
| Wuzhou, CN | 2 |
| FLASlocation not on record | 2 |
| Museo de Historia Natural de El Salvadorlocation not on record | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Montpellier, FR | 2 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| arosemena tola, EC | 2 |
| Fort Worth, US | 2 |
| Philadelphia, US | 2 |
| Pretoria, ZA | 2 |
| MEDELlocation not on record | 2 |
| University of Zhejianglocation not on record | 2 |
| ACT-Slocation not on record | 2 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 2 |
| Frankfurt am Main | 2 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 2 |
| Edinburgh, GB | 2 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 2 |
| OTSlocation not on record | 2 |
| Phoenix, US | 2 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 2 |
| Mount Annan, AU | 2 |
| UESBlocation not on record | 2 |
| UFMGlocation not on record | 2 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 2 |
| BAYLUlocation not on record | 2 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 2 |
| Bogotá, D.C., CO | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Jardín Botánico Nacional Dr. Rafael M. Moscosolocation not on record | 2 |
| Universidade Federal de Sergipe (UFS)location not on record | 2 |
| Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record | 2 |
| National Museums of Kenyalocation not on record | 2 |
| Kagoshima, JP | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| UNESClocation not on record | 2 |
| Iquitos, PE | 2 |
| Londrina, BR | 2 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 2 |
| Fredericksburg, US | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| IAPlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Honolulu, US | 1 |
| Palmerston, AU | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| DEAL Martiniquelocation not on record | 1 |
| LDlocation not on record | 1 |
| La Paz, MX | 1 |
| Mlocation not on record | 1 |
| Claremont, US | 1 |
| Ann Arbor, US | 1 |
| Hermosillo, MX | 1 |
| Universidad del Valle (UV)location not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Ciudad de México, MX | 1 |
| San Luis Potosí, MX | 1 |
| California Academy of Scienceslocation not on record | 1 |
| UNITINSlocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Salamanca, ES | 1 |
| Cruz das Almas, BR | 1 |
| CUVClocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| Castelar, AR | 1 |
| Smithfield, AU | 1 |
| Museum of Zoologylocation not on record | 1 |
| Arusha, TZ | 1 |
| Coimbra, PT | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Ulocation not on record | 1 |
| CHAPAlocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Brisbane, AU | 1 |
| Hobart, AU | 1 |
| UNEMATlocation not on record | 1 |
| HEMlocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Guasave, MX | 1 |
| Flagstaff, US | 1 |
| Criciúma, BR | 1 |
| Bangkok, TH | 1 |
| TAIElocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| UFSCarlocation not on record | 1 |
| Lima, PE | 1 |
| IPA/SPlocation not on record | 1 |
| Quito, EC | 1 |
| Managua, NI | 1 |
| Vietnam Academy of Science and Technology (VAST)location not on record | 1 |
| CEPLAClocation not on record | 1 |
| Faculty of Applied Science, University of Sri Jayawardenepuralocation not on record | 1 |
| Madison, US | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| DSMlocation not on record | 1 |
| UFESlocation not on record | 1 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 1 |
| Cornell Universitylocation not on record | 1 |
| XALlocation not on record | 1 |
| Mississippi State, US | 1 |
| Mexico City, MX | 1 |
| Zürich, CH | 1 |
| Minia, EG | 1 |
| Chaguaramas, TT | 1 |
| 2004."location not on record | 1 |
262 institutions · 4 521 of 4 747 vouchered records shown · 222 without an institution code
09Environmental DNA25 detections
Where the DNA of Cissampelos pareira was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found25
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 25 detections have coordinates
Open the map4 countries0
Forest
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median23.7 °C 12.1–27.1
Seasonal swing summer↔winter2.50 °C
Max temp (day)26.6 °C 17.6–30.2
Min temp (night)21.6 °C 5.40–22.9
Precipitation403 mm/mo 13.8–490
Air humidity70.8 % 46.5–75.7
Moisture balance264 mm/mo -93.9–362
Vapour deficit861 Pa 707–1,315
Wind speed2.80 m/s 1.10–4.30
Cloud cover37.2 % 11.8–39.2
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.