Cirsium wrightii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records49

Data sources5

Biological traits7

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Cirsium wrightii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF49 records

DNA & barcodingNCBIsequences

01Narrative

Cirsium wrightii, or Wright's marsh thistle, is an endangered species of North American plants in the family Asteraceae. It is a monocarpic perennial sometimes reaching as much as 300 cm (10 feet) in height. The species was originally collected in 1851 in Arizona by Charles Wright.Gray, Asa 1853. Smithsonian Contributions to Knowledge 5(6): 101

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium wrightii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN335140.1 ↗623 bpUSA · 2006

ACGT

AGCCTGCACAGCAGAACGACCCGTGGACACGTAATCACAGCCGGGCGTCGAGGGGGTCGGGCGTCAGCCCGGTGCCCGCGATGCCTTGTC …

Cirsium wrightii voucher UNM 6132 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type49 records

Wild obs. + sensor33

Museum / vouchered16

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 33

33 georeferenced

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Luis Obispo, US	6
EL PASO, US	3
Riverside, US	2
Austin, US	2
Bronx, US	1
Claremont, US	1
Chicago, US	1

7 institutions · 16 of 16 vouchered records shown