Cirsium waldsteinii

Rouy · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records259

Data sources8

Biological traits12

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Cirsium waldsteinii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility259 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF259 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 68

01Narrative

Rhaponticum coniferum, la leuzée conifère et surtout pomme-de-pin, est une espèce de plantes à fleurs de la famille des astéracées (composées). Cette plante surtout méditerranéenne pousse sur sol rocailleux et calcaire. Ce qu'on appelle les fleurs sont en réalité un capitule de fleurons reposant sur un involucre de bractées. Même si la métaphore avec une pomme de pin semble logique, on pensera plutôt à l'artichaut en observant cette plante. Ce qu'on voit sur la photo ci-contre est en effet un involucre de bractées comme le sont les « feuilles » d'artichaut. Les fleurs apparaissent plus tardivement sous forme d'une aigrette de fleurons tubulés.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max2 m

Plant height min0.7 m

Seed mass2.76 mg

Life cycle & reproduction5

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Habitat & environment4

Climatetemperate

Growth formherb

Habitat GIFTshrubberies

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium waldsteinii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSMN918968.1 ↗650 bp

ACGT

ATCATTGTCGAAGCCTGCACAGCAGAACGACCCGTGGACACGTAATCACAGCCGGGGTCGAGGGGGTCGGGCGTGAGCCCGGTGCCCGCG …

Cirsium waldsteinii internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Cirsium waldsteinii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Ploidypolyploid inferred

Chromosome records20–682n range68median68mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 687×CCDB · fl-europaea · CCDB · poland · CCDB · ipcn-api-dl +1

CCDB · fl-europaea — Mizianty & Frey,

CCDB · poland — Czapik R. 1958. Karyological studies in species of Cirsium Mill. em. Scop, occuring in Poland. Acta Soc. Bot. Pol. 27, 483-489.

CCDB · poland — Mizianty M. and Frey L. 1973. Chromosome number of some vascular plants in the Western Bieszczady Mts (south-eastern Poland). Fragm. Flor. Geobot. 19, 265-270.

CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.

CCDB · ipcn-api-dl — Mizianty, M. & L. Frey. 1973. Chromosome numbers of some vascular plants in the Western Bieszczady Mts. (South-eastern Poland). Fragm. Florist. Geobot. 19: 265–270.

CCDB · Cave1958 — Czapik 1958

2n 202×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Tasenkevitch, L. A., E. I. Vysotskaja & N. K. Vorobetz. 1989. Chromosome numbers in rare and endemic species of vascular plants from the Ukrainian Carpathians. Bot. Žhurn. (Moscow & Leningrad) 74: 1669–1670.

2n 342×CCDB · ipcn-api-dl · TreeOfSex · plant

CCDB · ipcn-api-dl — Dobea, C., M. Kiehn & E. Vitek. 1996. Beiträge zur Gefässpflanzen-Flora von Österreich: Chromosomenzählungen III. Verh. Zool.-Bot. Ges. Wien 133: 301–318.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type259 records

Wild obs. + sensor134

Museum / vouchered116

Other9

Range

Area of Occupancy AOO508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 100≤1 km 10≤10 km 4>10 km 1

115 georeferenced · 19 without coordinates

Open the mapobservation + sensor134

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 2≤1 km 63≤10 km 26>10 km 1

92 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record	14
Uniwersytet Wrocławskilocation not on record	13
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	12
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	6
Moscow State Universitylocation not on record	5
LDlocation not on record	5
Uniwersytet Śląski w Katowicachlocation not on record	3
Görlitz, DE	3
GZUlocation not on record	3
Frankfurt am Main	2
MAlocation not on record	1
Mlocation not on record	1
Provincia di Livornolocation not on record	1
Dresden, DE	1
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
BRNUlocation not on record	1
SZUlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

18 institutions · 74 of 116 vouchered records shown · 41 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)