Cirsium vulgare
(Savi) Ten. · speciesAt a glance
Occurrence records910 182
Data sources14
Biological traits75
DNA specimens102
eDNA detections58
Sources14 archives
Databases and archives Cirsium vulgare's data was compiled from.
WikipediaWikimedia Foundation16 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility910 182 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics102 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources75 traits
Occurrence & distributionGBIF910 182 records
Environmental DNA1 datasets · 11 countries58 detections
DNA & barcodingBOLD · NCBI102 specimens
Genome at a glanceCCDB · GIFT · GoaT2.8 Gbp
01Narrative
Cirsium vulgare, the spear thistle, bull thistle, or common thistle, is a species of the Asteraceae genus Cirsium, native throughout most of Europe (north to 66°N, locally 68°N), Western Asia (east to the Yenisei Valley), and northwestern Africa (Atlas Mountains).Flora Europaea: Cirsium vulgareDen Virtuella Floran: Cirsium vulgare (in Swedish, with maps)Altervista Flora Italiana, Cardo asinino, Cirsium vulgare (Savi) Ten.Flora of China, 翼蓟 yi ji, Cirsium vulgare (Savi) Tenore It is also naturalised in North America, Africa, and Australia and is an invasive weed in some areas.Flora of North America, Bull or common or spear thistle, gros chardon, chardon vulgaire ou lancéolé, piqueux, Cirsium vulgare (Savi) TenoreAtlas of Living Australia, Cirsium vulgare (Savi) Ten., Black ThistleConservatoire et Jardin botaniques & South African National Biodiversity Institute, African Plant Database, Cirsium vulgare (Savi) Ten. It is the national flower of Scotland. The plant provides a great deal of nectar for pollinators. It was rated in the top 10 for most nectar production (nectar per unit cover per year) in a UK plants survey conducted by the AgriLand project which is supported by the UK Insect Pollinators Initiative. Marsh thistle, Cirsium palustre, was ranked in first place while this thistle was ranked in sixth place. It also was a top producer of nectar sugar in another study in Britain, ranked third with a production per floral unit of (2300 ± 400 μg).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology25
Fruit length4 mm
Fruit length max50 mm
Fruit length min3 mm
Fruit width2 mm
Fruit width max2 mm
Fruit width min2 mm
Leaf length275 mm
⚠ sources differ — AusTraits: 275 mm · GIFT: 125 mm
Leaf length max450 mm
Leaf length min100 mm
Leaf mass613 mg
Leaf mass per area100 g/m2
Leaf size17 162 mm²
⚠ sources differ — TRY: 17 162 mm² · LEDA: 8 556 mm² · GIFT: 11 036 mm²
Leaf width100 mm
⚠ sources differ — AusTraits: 100 mm · GIFT: 45 mm
Leaf width max100 mm
Leaf width min30 mm
Plant height0.925 m
⚠ sources differ — GIFT: 0.925 m · AusTraits: 1.5 m · LEDA: 0.9 m · TRY: 1.5 m
Plant height generative0.95 m
Plant height max2 m
Plant height min0.05 m
Seed length3.62 mm
Seed length max3.5 mm
Seed length min3.5 mm
Seed mass2.74 mg
⚠ sources differ — TRY: 2.74 mg · AusTraits: 2.9 mg · LEDA: 2.51 mg · GIFT: 2.73 mg
Seed mass max4 mg
Seed mass min1.66 mg
Life cycle & reproduction21
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typewind
⚠ sources differ — AusTraits: anemochory · LEDA: epizoochor · GIFT: anemochorous
Flower colourred
Flower length max50 mm
Flower length min30 mm
Flowering endAug
Flowering startJul
Flowering timennnnnnnnynnn
Life formbiennial
Life spanbiennial
⚠ sources differ — TRY: biennial · AusTraits: biennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: biennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Reproductive maturity1 years
Resprouting capacityfire_killed
Seed number3 380
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 500 m
Elevation mean1 300 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTÁrea Antrópica, Campo Limpo
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapelanceolate obovate
Mycorrhiza type0.00000000376
Woodinessnon-woody
Physiology & chemistry7
Leaf dry-matter content (LDMC)148 mg/g
⚠ sources differ — TRY: 148 mg/g · LEDA: 128 mg/g
Leaf n32.5 mg/g
Leaf p3.25 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)14.27 mm²/mg
⚠ sources differ — TRY: 14.27 mm²/mg · LEDA: 14.1 mm²/mg · GIFT: 16.0 mm²/mg
Other traits5
Defenseyes
Diaspore typeone-seeded generative dispersule
Leaf arrangementalternate
Monocarpymonocarp
Seeds per fruit>1000
05DNA & barcoding102 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium vulgare has left across the world's sequence archives.
At a glance
DNA specimens102
Marker genes9
GenBank sequences10
eDNA detections58
Countries12
The DNA barcodea real sequence read deposited for this species
CGCATCGCGTCGCCCCAGACCACGTCTCCCCAACGAGGATGCGTTGTTTGTCTGGGGCGGAGAATGGTCTCCCGTGCCGTCGGCGCGGTT …
Cirsium vulgare voucher MX-34 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL2★rbcLa★trnL★ITS6★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · TreeOfSex
The complete instruction manual Cirsium vulgare carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 753 070 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cirsium vulgare2.75 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 68 n = 34
Ploidypolyploid inferred
Chromosome records34–1022n range68median68mode76records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 6862×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · slov-fl +15
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — PAVONE P., TERRASI M.C., ZIZZA A. - 1981. Chromosome number reports LXXII.. Taxon , 30(3): 695-696.
CCDB · ita-fl — ROMANO S., OTTONELLO D., MARCEN C. - 1995 (1994). Numeri Cromosomici per la Flora Italiana.. Inform. Bot. Ital. , 26(2-3): 191-199.
CCDB · ita-fl — SCRUGLI A., BOCCHIERI E. - 1977. Numeri cromosomici per la flora italiana:348-357.. Inform. Bot. Ital. , 9(2): 127-133.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · iber-fl — Contribucin al estudio cariolgico del gnero Cirsium en la pennsula Ibrica. Talavera, S.Lagascalia4(2): 285-296(1974).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3855
CCDB · fl-europaea — Fernandes d, Queiros,
CCDB · poland — Czapik R. 1958. Karyological studies in species of Cirsium Mill. em. Scop, occuring in Poland. Acta Soc. Bot. Pol. 27, 483-489.
CCDB · poland — Skali?ska M., Ma?ecka J., Izmai?ow R. et al. 1974. Further studies in chromosome numbers of Polish Angiosperms. Tenth contribution. Acta Biol. Cracov. Ser. Bot. 17, 133-163.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Tonian, T. R. 1982. New chromosome numbers of the species of Cirsium in Armenia. Ucen. Zap. Erevan Univ. 3: 115–120. (In Russian). ý.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Pavone, P., C. M. Terrasi & A. Zizza. 1981. In Chromosome number reports LXXII. Taxon 30: 695–696.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — Skalinska, M. 1974. Further studies in chromosome numbers of Polish angiosperms. X. Acta Biol. Cracov., Ser. Bot. 17: 133–164.
CCDB · ipcn-api-dl — Kuzmanov, B., S. Georgieva, V. Nikolova & I. Penceva. 1981a. In Chromosome number reports LXXII. Taxon 30: 701–702.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn75-78 — Scrugli & Bocchieri 1977
CCDB · book-northern-plants — Poddubnaja-Arnoldi 1931. L. & L. 1944 b.
CCDB · book-ipcn73-74 — TALAVERA, S. 1974. Contribucion al estudio cariologico del genera Cirsium en la peninsula Iberica. Lagascalia 4: 285-296.
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dJ spermatophyta de Portugal. 47(Ser. 2l: 299-314. II Compositae, supl. I Bol. Soc. Brot. I
CCDB · book-atlas-flowering-plants — Poddubnaja 1931
CCDB · kew — Bureš P, Wang Y-F, Horova L, Suda J. 2004. Genome size variation in Central European species of Cirsium (Compositae) and their natural hybrids. Annals of Botany 94: 353-363.
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S., Nikolova, V. & Penceva, I. (1981c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 701-702.
CCDB · CromoCat 2015 — Talavera, S. (1974). Contribución al estudio cariológico del género Cirsium en la Península Ibérica. Lagascalia 4(2): 285-296.
+22 more references
2n 348×GoaT · Tree of Sex Database · CCDB · iapt · CCDB · iber-fl +3
GoaT · Tree of Sex Database — ↗
CCDB · iapt
CCDB · iber-fl — Contribucin al estudio cariolgico del gnero Cirsium en la pennsula Ibrica. Talavera, S.Lagascalia4(2): 285-296(1974).
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Geogieva & V. T. Nikolova. 1991. Karyological study of Bulgarian plants from the family Compositae. IV. Tribus Cardueae Cass. Fitologija 39: 3–22.
CCDB · Cave1958 — Czapik 1958
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, M. (1991). Kariologicno izsledvane na balgarski Sloznocvetni. IV. Tribus Carduae Cass. Fitologija 39: 3-22.
2n 1024×CCDB · iber-fl · CCDB · fl-europaea · CCDB · book-ipcn67-71 +1
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · fl-europaea — Fernandes & Queiros,
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
GIFT · GIFT (floras)
2n 561×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 601×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Krasnikov, A. A., Zhirova, O. S., Lomonosova, M. N. & Smirnov, S. V. (2003). Chromosome numbers of Asteraceae from the southern Siberia and Kazakhstan. Bot. Žhurn. 88(9): 151–153.
n 171×CCDB · iber-fl
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 18-23. Talavera, S.Lagascalia7(2): 201-203(1977).
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type910 182 records
Wild obs. + sensor894 905
Museum / vouchered13 096
Cultivated / captive935
Other1 246
Origin
Native54 384
Introduced61 090
Range
Area of Occupancy AOO944 672 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy56% within 1 km
≤100 m 247 838≤1 km 188 415≤10 km 331 271>10 km 6 210
773 734 georeferenced · 121 171 without coordinates
Open the mapobservation + sensor894 905
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 1 032≤1 km 2 218≤10 km 4 563>10 km 270
8 083 georeferenced · 5 013 without coordinates
Open the institutions mapphysical evidence13 096
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 3>10 km 19
22 georeferenced · 913 without coordinates
Open the mapnot free-living935
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions254 of 461 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 557 |
| BIO-UNIPIlocation not on record | 479 |
| Madison, US | 269 |
| LDlocation not on record | 264 |
| Philadelphia, US | 224 |
| Moscow State Universitylocation not on record | 208 |
| Salzburg, AT | 203 |
| Adelaide, AU | 186 |
| Chongqing Museumlocation not on record | 182 |
| Wuzhou, CN | 168 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 167 |
| Christchurch, NZ | 149 |
| Uniwersytet Warszawskilocation not on record | 144 |
| Brisbane, AU | 135 |
| MeiseBGlocation not on record | 132 |
| St. Paul, US | 125 |
| Bronx, US | 121 |
| Pretoria, ZA | 120 |
| Oregon State Universitylocation not on record | 120 |
| San Diego, US | 118 |
| Museo Entomologico de Leonlocation not on record | 112 |
| Olocation not on record | 110 |
| Mount Annan, AU | 108 |
| South Kensington, GB | 105 |
| Claremont, US | 102 |
| Chicago, US | 99 |
| Riverside, US | 92 |
| SLU Artdatabankenlocation not on record | 86 |
| Hobart, AU | 85 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 84 |
| Kuopio, FI | 83 |
| WTUlocation not on record | 79 |
| Santa Barbara, US | 77 |
| Canberra, AU | 76 |
| Oskarshamn, SE | 72 |
| Oulu, FI | 71 |
| Québec, CA | 71 |
| Odawara, JP | 70 |
| Kensington, AU | 69 |
| GJOlocation not on record | 67 |
| BFLlocation not on record | 67 |
| Canadian Department of Agriculturelocation not on record | 64 |
| Karlsruhe, DE | 64 |
| Provincia di Livornolocation not on record | 59 |
| Berlin, DE | 57 |
| University of Wisconsinlocation not on record | 57 |
| BDBClocation not on record | 57 |
| Durban, ZA | 56 |
| Ann Arbor, US | 56 |
| Pullman, US | 54 |
| Auckland, NZ | 54 |
| Flagstaff, US | 54 |
| València, ES | 53 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 53 |
| Turku, FI | 52 |
| Bloomington, US | 52 |
| Trondheim, NO | 49 |
| Burlington, US | 48 |
| Entomological Society of Latvialocation not on record | 47 |
| Görlitz, DE | 47 |
| Allentown, US | 46 |
| BRNUlocation not on record | 45 |
| Davis, US | 43 |
| Corvallis, US | 42 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 42 |
| Saint Louis, US | 42 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 41 |
| Montréal, CA | 40 |
| MAlocation not on record | 39 |
| Acadia Universitylocation not on record | 39 |
| Barcelona, ES | 39 |
| Pamplona, ES | 38 |
| Corrientes, AR | 37 |
| San Luis Obispo, US | 36 |
| Moscow, US | 35 |
| Kawasaki Shi Tama Ku, JP | 35 |
| Albuquerque, US | 35 |
| Bergen, NO | 35 |
| Bern, CH | 34 |
| San Isidro, AR | 34 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 34 |
| BClocation not on record | 33 |
| Blumenau, BR | 32 |
| Cape Town, ZA | 32 |
| New Brunswick, US | 31 |
| Angwin, US | 30 |
| Vitoria, ES | 30 |
| Arcata, US | 30 |
| Williamsburg, US | 30 |
| Córdoba, AR | 29 |
| Austin, US | 28 |
| KMNlocation not on record | 28 |
| Saint John, CA | 28 |
| Jyväskylä, FI | 28 |
| Missoula, US | 28 |
| University of New Hampshirelocation not on record | 27 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 27 |
| GZUlocation not on record | 27 |
| Provo, US | 26 |
| San Sebastián, ES | 26 |
| Vancouver, CA | 26 |
| Armidale, AU | 25 |
| ISAlocation not on record | 24 |
| Phoenix, US | 24 |
| ASUlocation not on record | 24 |
| University of Stellenboschlocation not on record | 23 |
| Université Lavallocation not on record | 23 |
| Chadron, US | 23 |
| New Haven, US | 22 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 22 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 21 |
| CASlocation not on record | 21 |
| Nagano City, JP | 21 |
| Green Bay, US | 21 |
| Denver, US | 20 |
| TUR-Alocation not on record | 20 |
| Bangkok, TH | 20 |
| Emporia, US | 20 |
| Victoria, CA | 20 |
| Bozeman, US | 20 |
| Tsukuba, JP | 20 |
| Sanda, JP | 20 |
| McWane Science Centerlocation not on record | 19 |
| UGentlocation not on record | 19 |
| Wlocation not on record | 19 |
| Wellington, NZ | 18 |
| Logan, US | 18 |
| Toronto, CA | 17 |
| Spearfish, US | 17 |
| College Park, US | 17 |
| US | 16 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 16 |
| San Francisco, US | 15 |
| Salamanca, ES | 15 |
| Laboratory of Palaeontologylocation not on record | 15 |
| Pittsburg, US | 15 |
| Kew, GB | 15 |
| TROMlocation not on record | 14 |
| Columbia, US | 14 |
| Mlocation not on record | 14 |
| Badajoz, ES | 13 |
| Irvine, US | 13 |
| Fayetteville, US | 12 |
| Caldwell, US | 12 |
| Smithfield, AU | 12 |
| GMBAlocation not on record | 12 |
| Keene State Universitylocation not on record | 12 |
| Parkville, AU | 11 |
| BISHlocation not on record | 11 |
| Rotorua, NZ | 11 |
| University of Alberta Museumslocation not on record | 11 |
| Frankfurt am Main | 11 |
| Madrid, ES | 11 |
| Severin-McDaniel Insect Collectionlocation not on record | 11 |
| Urumqi, CN | 10 |
| Jackson, US | 10 |
| Dekalb, US | 10 |
| Pocatello, US | 10 |
| IDElocation not on record | 10 |
| Mexico City, MX | 9 |
| Otaru, JP | 9 |
| Porto Alegre, BR | 9 |
| Santa Cruz, US | 9 |
| Kushiro City Museumlocation not on record | 9 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 9 |
| College of the Atlantic, Museumlocation not on record | 9 |
| Boise, US | 9 |
| Universidade Federale do Rio Grande do Sullocation not on record | 9 |
| Akita Prefectural Museumlocation not on record | 9 |
| UChlocation not on record | 9 |
| USFS/BHSClocation not on record | 8 |
| Stockholm, SE | 8 |
| Zürich, CH | 8 |
| DASSHlocation not on record | 8 |
| Portland, US | 8 |
| Millersville, US | 8 |
| Beijing, CN | 8 |
| Los Angeles, US | 8 |
| Porrentruy, CH | 8 |
| Staten Island, US | 8 |
| DOI/NPS, Greenbelt Parklocation not on record | 8 |
| Natural History Museum Rotterdamlocation not on record | 8 |
| Chicago, US | 8 |
| Mississippi State, US | 7 |
| Whitewater, US | 7 |
| Tallinn, EE | 7 |
| Chapel Hill, US | 7 |
| Morgantown, US | 7 |
| Alicante, ES | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| DBF-NHMDlocation not on record | 7 |
| Tartu, EE | 7 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 7 |
| John T. Waterhouse Herbariumlocation not on record | 7 |
| Porvoo, FI | 7 |
| Bando, JP | 7 |
| Paris, FR | 7 |
| CICYTEXlocation not on record | 7 |
| EL PASO, US | 7 |
| PRClocation not on record | 6 |
| Jaén, ES | 6 |
| Tacoma, US | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| Brookings, US | 6 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 6 |
| Córdoba, ES | 6 |
| SIHUlocation not on record | 6 |
| KIRMlocation not on record | 6 |
| Granada, ES | 6 |
| CJBGlocation not on record | 6 |
| Cuenca, EC | 6 |
| Norfolk, US | 6 |
| Sagamihara, JP | 6 |
| Chiba, JP | 6 |
| PUC-RSlocation not on record | 6 |
| UTFPR-CPlocation not on record | 6 |
| Hudson, US | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| UDESC-CAVlocation not on record | 5 |
| Washington, US | 5 |
| Wollongong, AU | 5 |
| Pamplona, ES | 5 |
| Knoxville, US | 5 |
| Lanzhou, CN | 5 |
| Frauenfeld, CH | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| Philadelphia, US | 5 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 5 |
| Fukushima Universitylocation not on record | 5 |
| Ashland, US | 5 |
| University of Southern Mississippilocation not on record | 5 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 5 |
| Dresden, DE | 5 |
| Harrisonburg, US | 5 |
| Cheney, US | 5 |
| Fulda, DE | 5 |
| Tuscaloosa, US | 5 |
| QVMAGlocation not on record | 5 |
| Tilburg, NL | 5 |
| QCNElocation not on record | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Lincoln, US | 4 |
| Philadelphia, US | 4 |
| Batemans Bay, AU | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| JP | 4 |
| PrivatHerblocation not on record | 4 |
| Uniwersytet Opolskilocation not on record | 4 |
| Castelar, AR | 4 |
| Campo Mourão, BR | 4 |
| USFSlocation not on record | 4 |
| Northridge, US | 4 |
| Museum of the Rockieslocation not on record | 4 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 4 |
| Tromso University Museumlocation not on record | 4 |
| Western Carolina Universitylocation not on record | 4 |
| Mount Pleasant, US | 4 |
| Kiritappu Wetland National Trustlocation not on record | 4 |
| UEPAlocation not on record | 4 |
| Fairfax, US | 4 |
| Mount Berry, US | 4 |
| Rovaniemi, FI | 4 |
| Honolulu, US | 4 |
| Durango, US | 4 |
| Forssa, FI | 4 |
| FLADlocation not on record | 3 |
| NSW Office of Environment and Heritagelocation not on record | 3 |
| University of Johannesburglocation not on record | 3 |
| Sevilla, ES | 3 |
| Lord Fairfax Community Collegelocation not on record | 3 |
| Maringá, BR | 3 |
| Ivano-Frankove, UA | 3 |
| Shinshu Universitylocation not on record | 3 |
| Clemson, US | 3 |
| Johnson City, US | 3 |
| Grand Junction, US | 3 |
| Iwate Prefectural Museumlocation not on record | 3 |
| UFPRlocation not on record | 3 |
| GAlocation not on record | 3 |
| San Bernardino, US | 3 |
| Palmerston, AU | 3 |
| Xiamen, CN | 3 |
| GB | 3 |
| La Trobe Universitylocation not on record | 3 |
| Royal Botanical Gardenslocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Osaka, JP | 3 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 3 |
| Ivano-Frankivsk, UA | 3 |
| Bandelier National Monumentlocation not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| Palacký University in Olomouclocation not on record | 3 |
| Tomioka, JP | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| OLAlocation not on record | 3 |
| Durham, US | 3 |
| Long Beach, US | 3 |
| Xining, CN | 3 |
| Ural Federal University "B. N. Yeltsin"location not on record | 3 |
| Fort Worth, US | 3 |
| UIBlocation not on record | 3 |
| China Agricultural Universitylocation not on record | 2 |
| Turlock, US | 2 |
| Hiratsuka City Museumlocation not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Glarus, CH | 2 |
| Göteborg, SE | 2 |
| Oswego, US | 2 |
| Tampa, US | 2 |
| Chicago, US | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Helsinki, FI | 2 |
| Valparaiso, CL | 2 |
| Uppsala, SE | 2 |
| Royal Botanic Garden Edinburghlocation not on record | 2 |
| McGill University, Herbariumlocation not on record | 2 |
| Cenargenlocation not on record | 2 |
| San Angelo, US | 2 |
| Brasília, BR | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| EEZA-CSIClocation not on record | 2 |
| J.F.Oberlin Universitylocation not on record | 2 |
| Cruz das Almas, BR | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Springfield, US | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| JBSlocation not on record | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Zürich, CH | 2 |
| CUVClocation not on record | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| WINlocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| Fundación Miguel Lillolocation not on record | 2 |
| Ciudad Autónoma de Buenos Aires, AR | 2 |
| Macomb, US | 2 |
| Bourges, FR | 2 |
| Tempe, US | 2 |
| Orem, US | 2 |
| Minia, EG | 2 |
| National Museum Waleslocation not on record | 2 |
| Bothell, US | 2 |
| Walla Walla, US | 2 |
| Ensenada, MX | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Portland, US | 2 |
| Jefferson City, US | 2 |
| US | 2 |
| Tula State Universitylocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| Bogotá, D.C., CO | 2 |
| Kingston, US | 2 |
| San Salvador de Jujuy, AR | 2 |
| University of Tennessee at Chattanoogalocation not on record | 2 |
| Little Rock, US | 2 |
| Catalina Island Conservancylocation not on record | 2 |
| ZRC-SAZUlocation not on record | 2 |
| BMlocation not on record | 1 |
| Baltimore, US | 1 |
| Palmerston North, NZ | 1 |
| H-Schuhwlocation not on record | 1 |
| Aarhus, DK | 1 |
| Umeå Universitylocation not on record | 1 |
| Altos de Pipe, VE | 1 |
| Edinburgh, GB | 1 |
| Sant Julià de Lòria, AD | 1 |
| ULBF-AGRlocation not on record | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| Valparaíso, CL | 1 |
| Fullerton, US | 1 |
| CONCOLlocation not on record | 1 |
| Masindi, UG | 1 |
| UFSClocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| La Paz, MX | 1 |
| H-Dunkellocation not on record | 1 |
| Ypsilanti, US | 1 |
| Banyoles, ES | 1 |
| Nijmegen, NL | 1 |
| Cusco, PE | 1 |
| Durango, MX | 1 |
| Kirksville, US | 1 |
| Trois-Rivières, CA | 1 |
| JBRJlocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Riobamba, EC | 1 |
| NMBU:MINAlocation not on record | 1 |
| UFABClocation not on record | 1 |
| Criciúma, BR | 1 |
| SZUlocation not on record | 1 |
| University of British Columbialocation not on record | 1 |
| Miami, US | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| KNFYlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Taipei, TW | 1 |
| REALlocation not on record | 1 |
| Whitehorse, CA | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| ESP109location not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Nantes Culture Collectionlocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Davenport, US | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| Berea Collegelocation not on record | 1 |
| VALElocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| UTPLlocation not on record | 1 |
| Fredericksburg, US | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| ESP003location not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Elikins, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Conway, US | 1 |
| Richmond, US | 1 |
| SEFlocation not on record | 1 |
| Uberlândia, BR | 1 |
| Universidad Nacional de Asunciónlocation not on record | 1 |
| Henderson State Universitylocation not on record | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| INFlocation not on record | 1 |
| Montréal, CA | 1 |
| Monastir, TN | 1 |
| UTFPR-DVlocation not on record | 1 |
| Sion, CH | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Toyama, JP | 1 |
| BSBIlocation not on record | 1 |
| Coimbra, PT | 1 |
| Sapporo, JP | 1 |
| BGBMlocation not on record | 1 |
| MMHNSRlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| nbflocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| La Paz, BO | 1 |
| San Jose, US | 1 |
| UNESClocation not on record | 1 |
| AUAlocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
461 institutions · 12 200 of 13 096 vouchered records shown · 790 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA58 detections
Where the DNA of Cirsium vulgare was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found58
Studies independent surveys1
Countries11
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 58 detections have coordinates
Open the map11 countries0
Disturbed Coastal Sage Scrub with Baccharis …edge of woodlandunder tree in grassy habitat
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.4 °C 10.7–20.1
Seasonal swing summer↔winter15.2 °C
Max temp (day)20.2 °C 13.3–25.3
Min temp (night)12.2 °C 8.30–15.8
Precipitation78.6 mm/mo 59.1–118
Air humidity59.9 % 54.1–64.1
Moisture balance-29.8 mm/mo -73.1–27.1
Vapour deficit782 Pa 475–1,014
Wind speed3.30 m/s 2.20–5.80
Cloud cover40.9 % 19.9–57.6
CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.