Cirsium pumilum

(Nutt.) Spreng. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records980

Data sources11

Biological traits11

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Cirsium pumilum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility980 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF980 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 30

01Narrative

Cirsium pumilum, the pasture thistle, is a North American species of plants in the tribe Cardueae within the family Asteraceae. The species is native to the northeastern and north-central United States as well as to the Canadian Province of Ontario.Biota of North America Program 2014 county distribution map, Cirsium pumilumBiota of North America Program 2014 county distribution map, Cirsium hillii Cirsium pumilum is a biennial or perennial herb up to 100 cm (40 inches) tall, blooming once before dying. It has leaf blades up to 30 cm (12 inches) long, with slender to stout spines. There are usually a few flower heads, sweetly scented, with pink, purple or white disc florets but no ray florets.Flora of North America, Pasture thistle, Cirsium pumilum (Nuttall) Sprengel, Syst. Veg. 3: 375. 1826. Varieties Cirsium pumilum var. hillii (Canby) B. Boivin - Great Lakes region, upper Mississippi Valley Cirsium pumilum var. pumilum - northeastern + east-central United States from Maine to South Carolina west to Ohio

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass3.75 mg

Seed mass max3.75 mg

Seed mass min3.75 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium pumilum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG218045.1 ↗349 bpUSA · 1892

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Cirsium pumilum voucher CCDB-22990-A04 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cirsium pumilum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–302n range30median30mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 308×CCDB · book-ipcn66 · CCDB · book-ipcn67-71 · CCDB · eflora +1

CCDB · book-ipcn66 — Moore & Frankton 1966

CCDB · book-ipcn67-71 — OWNBEY, G.B., & W.A. OLSON. 1969. Cytotaxonomic notes on the species of Cirsium native to the Southeastern United States. Rhodora 71: 285-296.

CCDB · eflora

CCDB · Cave1963 — Ownbey & Hsi 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type980 records

Wild obs. + sensor543

Museum / vouchered437

Range

Area of Occupancy AOO2 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 300≤1 km 52≤10 km 28>10 km 84

464 georeferenced · 79 without coordinates

Open the mapobservation + sensor543

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 12≤1 km 68≤10 km 270>10 km 22

372 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence437

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	152
Chongqing Museumlocation not on record	92
New Haven, US	25
Oregon State Universitylocation not on record	23
Allentown, US	18
University of New Hampshirelocation not on record	18
University of Stellenboschlocation not on record	12
New Brunswick, US	8
Burlington, US	7
Staten Island, US	7
Williamsburg, US	6
Keene State Universitylocation not on record	4
Bangkok, TH	4
Philadelphia, US	4
Madison, US	3
Chapel Hill, US	3
Bronx, US	2
Mississippi State, US	2
Hamilton, US	2
Görlitz, DE	2
Denver, US	1
Western Carolina Universitylocation not on record	1
Harrisonburg, US	1
Davenport, US	1
Chicago, US	1
Kingston, US	1
Chicago, US	1
Istituto Agrario Castelnuovolocation not on record	1
West Virginia Wesleyan Collegelocation not on record	1
Science Museum of Minnesotalocation not on record	1
WTUlocation not on record	1
Maryland Department of Natural Resourceslocation not on record	1
Lord Fairfax Community Collegelocation not on record	1
Bloomington, US	1
McWane Science Centerlocation not on record	1

35 institutions · 409 of 437 vouchered records shown · 28 without an institution code

09Environmental DNA2 detections

Where the DNA of Cirsium pumilum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)