Cirsium pitcheri

(Torr. ex Eaton) Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records1 900

Data sources11

Biological traits8

DNA specimens14

eDNA detections8

Sources11 archives

Databases and archives Cirsium pitcheri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 900 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF1 900 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD · NCBI14 specimens

Genome at a glanceCCDB1.2 Gbp

01Narrative

Cirsium pitcheri, sometimes called Pitcher's thistle or dune thistle, is a species of thistle native to sand dune shorelines along the upper Great Lakes. It is native to Indiana, Illinois, Michigan, Wisconsin, and Ontario. It is listed by the U.S. Fish and Wildlife Service as a threatened species.United States Fish & Wildlife Service. 2005. Threatened and Endangered Animals and Plants, Species Information. Species Information Threatened and Endangered Animal and Plants

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction2

Life spanperennial

⚠ sources differ — TRY: perennial · GIFT: biennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium pitcheri has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes5

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG219952.1 ↗349 bpCanada · 1961

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Cirsium pitcheri voucher CCDB-22990-E04 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cirsium pitcheri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 173 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Cirsium pitcheri1.17 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidypolyploid inferred

Chromosome records34–342n range34median34mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 342×CCDB · eflora · CCDB · Cave1963

CCDB · eflora

CCDB · Cave1963 — Moore & Frank. 1963; Ownbey & Hsi 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 900 records

Wild obs. + sensor1 861

Museum / vouchered39

Range

Area of Occupancy AOO5 264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy6% within 1 km

≤100 m 94≤1 km 14≤10 km 2>10 km 1 719

1 829 georeferenced · 32 without coordinates

Open the mapobservation + sensor1 861

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 2≤10 km 9>10 km 1

12 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	14
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	5
Chicago, US	4
Québec, CA	3
Chicago, US	3
Acadia Universitylocation not on record	2
Wuzhou, CN	2
Montréal, CA	2
University of Alberta Museumslocation not on record	2
Uppsala, SE	1
Science Museum of Minnesotalocation not on record	1

11 institutions · 39 of 39 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Cirsium pitcheri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

Sand dunes along lake.In sandIn sand dunes.In damp sand along upper beachSand dunes

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cirsium pitcheri

At a glance

Sources11 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment5

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 900 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 900 records