Cirsium ochrocentrum

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records1 055

Data sources12

Biological traits10

DNA specimens4

eDNA detections2

Sources12 archives

Databases and archives Cirsium ochrocentrum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 055 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF1 055 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 32

01Narrative

Cirsium ochrocentrum is a species of thistle known by the common name yellowspine thistle. It is native to the Great Plains of the Central United States and to the desert regions of the western United States and northern Mexico. Its range extends from eastern Oregon east to the Black Hills of South Dakota, south as far as the Mexican State of Durango.Biota of North America Program 2014 county distribution mapFlora of North America, Cirsium ochrocentrum A. GrayCalFlora taxon report, University of California: Cirsium ochrocentrum

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

⚠ sources differ — TRY: perennial · GIFT: biennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium ochrocentrum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences8

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN604571.1 ↗608 bpUSA · 2001

ACGT

CCCGTGGACAGTAATCACAGCGGGCGTCGAGGGGGTCGGGCGTCAGCCCGGTGCCCGCGATGCCTCGTCGACGTGCGCCCGGATGCCCCG …

Cirsium ochrocentrum voucher OBI 60392 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK4rbcLaITS4ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Cirsium ochrocentrum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records32–322n range32median32mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 323×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Ownbey, G. B., P. H. Raven & D. W. Kyhos. 1975 [1976]. Chromosome numbers in some North American species of the genus Cirsium. III. Western United States, Mexico, and Guatemala. Brittonia 27(4): 297–304.

TreeOfSex · plant — Goldblatt1979 ↗

n 171×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — OWNBEY, G.B. 1968. Cytotaxonomic notes on eleven species of Cirsium native to Mexico. Brittonia 20: 336-342.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 055 records

Wild obs. + sensor439

Museum / vouchered616

Range

Area of Occupancy AOO3 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 217≤1 km 48≤10 km 16>10 km 51

332 georeferenced · 107 without coordinates

Open the mapobservation + sensor439

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 33≤1 km 134≤10 km 145>10 km 33

345 georeferenced · 271 without coordinates

Open the institutions mapphysical evidence616

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions35 of 47 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	99
Bronx, US	72
DOI/NPS, Greenbelt Parklocation not on record	53
EL PASO, US	39
Austin, US	38
Flagstaff, US	36
DOI/NPS, Colonial National Historical Parklocation not on record	35
Canadian Department of Agriculturelocation not on record	33
Fort Worth, US	30
Lubbock, US	25
Musee des Dinosaures d'Esperaza (Aude)location not on record	23
Denver, US	22
Chicago, US	20
Riverside, US	10
Phoenix, US	7
Austin, US	6
Moscow, US	5
Claremont, US	5
San Diego, US	5
San Luis Obispo, US	5
San Angelo, US	4
Chadron, US	3
Pittsburg, US	3
Durango, MX	3
Saint Louis, US	3
Tempe, US	2
Bangkok, TH	2
Santa Barbara, US	2
Mexico City, MX	2
US	2
Hermosillo, MX	2
University of Stellenboschlocation not on record	2
Orem, US	1
Chongqing Museumlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Fredericton Stock Culture Collectionlocation not on record	1
USFSlocation not on record	1
Madison, US	1
Lincoln, US	1
Davis, US	1
Angwin, US	1
Zacatecas, MX	1
Grand Junction, US	1
KNFYlocation not on record	1
Emporia, US	1
The University of Arizonalocation not on record	1
ASUlocation not on record	1

47 institutions · 613 of 616 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Cirsium ochrocentrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 13.1–18.2

Seasonal swing summer↔winter18.7 °C

Max temp (day)21.5 °C 19.0–24.0

Min temp (night)11.2 °C 8.80–13.6

Precipitation41.2 mm/mo 10.5–72.0

Air humidity59.5 % 57.8–61.3

Moisture balance-91.3 mm/mo -134–-48.9

Vapour deficit785 Pa 743–827

Wind speed3.50 m/s 1.70–5.30

Cloud cover26.3 % 17.9–34.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources12 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 055 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions35 of 47 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 055 records