Cirsium lecontei

Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records215

Data sources9

Biological traits7

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Cirsium lecontei's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility215 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF215 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 28

01Narrative

LeConte's thistle Cirsium lecontei, often called the Le Conte's thistle, is a North American plant species native to the southeastern United States. It is a perennial, or sometimes biennial, species of the tribe Cardueae within the family Asteraceae. It grows along the coastal plain from Louisiana to North Carolina.Biota of North America Program 2014 county distribution map The flowering season is mainly spring to summer.(2006): 24. Cirsium lecontei. In: Flora of North America North of Mexico Vol. 19 (Magnoliophyta: Asteridae, part 6: Asteraceae, part 1). Oxford University Press. HTML fulltext

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium lecontei has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN604565.1 ↗614 bpUSA · 2006

ACGT

CCCGTGGACACGTAATCACAGCCGGGCGTTGAGGGGGTCGGGCGTCAGCCCGGTGCCCGCGATGCCTTGTCGTCGTGCGTCCGCGATGCC …

Cirsium lecontei voucher USCH 98049 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cirsium lecontei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–402n range33median28mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 284×CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · book-ipcn67-71 — MOORE, R.J., & C. FRANKTON. 1969. Cytotaxonomy of some Cirsium species of the eastern United States, with a key to eastern species. Canad. J. Bot. 4 7 : 125 7 - 12 7 5 .

CCDB · book-ipcn67-71 — OWNBEY, G.B., & W.A. OLSON. 1969. Cytotaxonomic notes on the species of Cirsium native to the Southeastern United States. Rhodora 71: 285-296.

CCDB · eflora

2n 343×CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · book-indian_vol1 — Poddubnaja-Arnoldi, V. 1931 ; Tis- chler, G. 1934, 1937; Rohweder, H. 1937 ; Ehrenberg, L. 1945 ; Heiser, C. B. & Whitaker, T.W. 1948; P6lya, L. 1950 ; Love, A. & Love, D. 1956b ; Moore, R.J. & Frankton, C. 1962 ; Gadella, T. W.J. & Kliphuis, E. 1963 ; Taylor, R. L. & Mulligan, G.A. 1968; Maj.ovsky, J. et al. 1970b ; Fernandes, A. & Queiros, M. 1971 ; Tomkins, D.J, & Grant, W.F. 1978; Van Loon, J. Chr. & de Jong, H. 1978; Brand, C.V. D. et al. 1979 ; Kliphuis, E. & Wieffe ring, J. H. 1979; Bir, S.S. & Sidhu, M. 1980

CCDB · book-indian_vol1 — Mehra, P.N. & Sidhu, S.S. 1960 ; Mehra, P.N. et al.1965; Mehra, P.N. & Remanandan, P. 1976

CCDB · book-fedorov — Mehra P. N. et al. 1965

2n 321×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — OWNBEY, G.B., & W.A. OLSON. 1969. Cytotaxonomic notes on the species of Cirsium native to the Southeastern United States. Rhodora 71: 285-296.

2n 361×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Gupta, P.K. et al. 1972

2n 401×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Sarkar, A.K., Chakraverty, M. et al. 1977

n 172×CCDB · book-ipcn65 · CCDB · ipcn-api-dl

CCDB · book-ipcn65 — Mehra et al. 1965

CCDB · ipcn-api-dl — Mehra, P. N. & P. REMANANDAN. 1976. Cytological investigations on Indian Compositae V. Tribes: Arctotideae, Cynareae, Calenduleae and Mutiseae. Nucleus 19: 8–12.

n 111×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — JONES, S.B. Jr. 1968. Chromosome numbers in southeastern United States Compositae I. Bull. Torrey Bot. Club 95: 393-395.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type215 records

Wild obs. + sensor154

Museum / vouchered61

Range

Area of Occupancy AOO548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 53≤1 km 7≤10 km 8>10 km 57

125 georeferenced · 29 without coordinates

Open the mapobservation + sensor154

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 2≤10 km 3>10 km 3

9 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	19
Bronx, US	13
Tampa, US	8
Chicago, US	4
University of Stellenboschlocation not on record	4
Miami, US	3
Wuzhou, CN	2
Chapel Hill, US	2
Tall Timbers Research Stationlocation not on record	2
Oskarshamn, SE	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
Bangkok, TH	1

13 institutions · 61 of 61 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Cirsium lecontei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)