Cirsium helenioides

(L.) Hill · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records9 768

Data sources13

Biological traits48

DNA specimens11

eDNA detections6

Sources13 archives

Databases and archives Cirsium helenioides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 768 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources48 traits

Chemical compositionLOTUS · NPASS100 compounds

Occurrence & distributionGBIF9 768 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 34

01Narrative

Cirsium helenioides là một loài thực vật có hoa trong họ Cúc. Loài này được (L.) Hill mô tả khoa học đầu tiên năm 1768.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology21

Fruit length4.5 mm

Fruit length max4.5 mm

Fruit length min4.5 mm

Fruit width2 mm

Fruit width max2 mm

Fruit width min2 mm

Leaf length200 mm

Leaf length max300 mm

Leaf length min100 mm

Leaf mass481 mg

Leaf size12 024 mm²

Leaf width50 mm

Leaf width max60 mm

Leaf width min40 mm

Plant height0.863 m

⚠ sources differ — GIFT: 0.863 m · LEDA: 0.55 m · TRY: 0.61 m

Plant height generative0.861 m

Plant height max2 m

Plant height min0.35 m

Seed mass1.78 mg

Seed mass max1.78 mg

Seed mass min1.78 mg

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal typeanimal

⚠ sources differ — LEDA: dysochor · GIFT: anemochorous

Flowering endAug

Flowering startJul

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifespan years2 years

Raunkiær life formhemicryptophyte

Seed number290

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 250 m

Elevation mean1 975 m

Elevation min1 700 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, forest edges, lakes, meadows, mountains, rivers, shores

Mycorrhiza type0.0000000035

Woodinesswoody

⚠ sources differ — TRY: W · LEDA: non-woody · GIFT: woody

Physiology & chemistry4

Leaf dry-matter content (LDMC)109 mg/g

Photosynthetic pathwayC3

Seed longevity index0

Specific leaf area (SLA)26.4 mm²/mg

Other traits1

Diaspore typefruit

03Chemical composition100 compounds

Compounds documented for Cirsium helenioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pimarane and Isopimarane diterpenoids28

Hydrocarbons7

Flavones6

Fatty alcohols5

Cinnamic acids and derivatives5

Documented compounds100 total

Tissue Source Quantified only

Compound	Amount	Source
(1R)-1-(7,8-dimethoxy-2,2-dimethylchromen-6-yl)ethanol	present	NPASS
(2R,3R)-2-hept-6-enyl-3-[(2Z,5Z)-octa-2,5-dienyl]oxirane	present	LOTUS
(4E,6E)-tetradeca-4,6-dien-8,10,12-triyn-1-ol	present	LOTUS
(8R,9S,11Z,14Z)-heptadeca-1,11,14-triene-8,9-diol	present	LOTUS
(S)-Rosmarinic acid	present	NPASS
(Z,Z)-1,8,11-Heptadecatriene	present	LOTUS
(Z,Z,Z)-1,8,11,14-Heptadecatetraene	present	LOTUS
1,11-Tridecadiene-3,5,7,9-tetrayne	present	LOTUS
1-(7,8-Dimethoxy-2,2-dimethyl-2H-1-benzopyran-6-yl)ethanone	present	NPASS
1-Tridecene-3,5,7,9,11-pentayne	present	LOTUS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium helenioides has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes5

GenBank sequences4

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX454377.1 ↗722 bpRussia · 2023

ACGT

GAGAAGTTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAGCCTGCACAGCAGGAACGACCCGTGGACACGTAAT …

Cirsium helenioides cultivar wild thistle small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL3★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Cirsium helenioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome records22–342n range34median34mode14records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3412×CCDB · ita-fl · CCDB · iapt · CCDB · ipcn-api-dl +2

CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.

CCDB · iapt — IAPT/IOPB Chromosome Data 9

CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.

CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk

CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1975. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 60(6): 864–872.

CCDB · ipcn-api-dl — Krogulevich, R. E. 1971. The role of polyploidy in the genesis of the alpine flora of the Stanovoye Nagorye Mountains. Pp. 115- 214 in The ecology of the flora of the Trans-Baikal region. Irkutsk.

CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Acad. Sci. USSR, Ser. Biol. 15(3): 46–52.

CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.

CCDB · eflora

CCDB · iapt — IAPT/IOPB Chromosome Data 26

CCDB · iapt — IAPT/IOPB Chromosome Data 28

TreeOfSex · plant — Goldblatt1979 ↗

2n 222×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type9 768 records

Wild obs. + sensor9 328

Museum / vouchered418

Cultivated / captive11

Other11

Origin

Introduced6

Range

Area of Occupancy AOO18 944 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 1 148≤1 km 744≤10 km 2 987>10 km 116

4 995 georeferenced · 4 333 without coordinates

Open the mapobservation + sensor9 328

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 37≤1 km 52≤10 km 196>10 km 13

298 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence418

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 6>10 km 4

10 georeferenced · 1 without coordinates

Open the mapnot free-living11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	81
Moscow State Universitylocation not on record	68
Jyväskylä, FI	68
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	26
Dresden, DE	20
KMNlocation not on record	17
TROMlocation not on record	17
Bern, CH	16
Beijing, CN	7
BRNUlocation not on record	7
BFLlocation not on record	6
IB FRC Komi SC UB RASlocation not on record	6
Urumqi, CN	6
Görlitz, DE	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Canadian Department of Agriculturelocation not on record	4
Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record	3
Bergen, NO	3
Karlsruhe, DE	3
Tromso University Museumlocation not on record	3
Uppsala, SE	3
Porrentruy, CH	3
Kuopio, FI	2
EL PASO, US	2
Mlocation not on record	2
Saint Louis, US	2
Finnish Museum of Natural History, Botanical Museumlocation not on record	2
Berlin, DE	2
Universidad del Pais Vasco (UPV/EHU)location not on record	2
CJBGlocation not on record	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
BClocation not on record	1
Bloomington, US	1
Barcelona, ES	1
Frankfurt am Main	1
Fribourg, CH	1
Xining, CN	1
Podgorica, ME	1
Glarus, CH	1
Xiamen, CN	1
Dhaka, BD	1
Naturkundliche Sammlung Urilocation not on record	1
AUAlocation not on record	1
H-Schuhwlocation not on record	1

45 institutions · 405 of 418 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Cirsium helenioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 5.80–15.7

Seasonal swing summer↔winter23.1 °C

Max temp (day)12.3 °C 7.80–19.2

Min temp (night)8.30 °C 3.00–12.5

Precipitation95.8 mm/mo 71.7–110

Air humidity64.7 % 60.9–66.2

Moisture balance11.9 mm/mo -10.5–48.3

Vapour deficit456 Pa 357–702

Wind speed2.90 m/s 2.50–4.90

Cloud cover57.9 % 48.6–66.6

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cirsium helenioides

At a glance

Sources13 archives

Size & morphology21

Life cycle & reproduction10

Diet & foraging1

Habitat & environment11

Physiology & chemistry4

Other traits1

Compound class profile5 classes

Documented compounds100 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type9 768 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 45 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 768 records