Cirsium grahamii

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records91

Data sources8

Biological traits8

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Cirsium grahamii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility91 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF91 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · TreeOfSex2n = 32

01Narrative

Cirsium grahamii, called Graham's thistle, is a North American species of plants in the tribe Cardueae within the family Asteraceae. The species is native to Sonora, Chihuahua, Durango, Nuevo León, New Mexico, and Arizona.Biota of North America Program 2014 county distribution mapTropicos, Cirsium grahamii A. Gray Cirsium grahamii is a biennial herb up to 100 cm (40 inches) tall, blooming only once before dying. Leaves have thin spines along the edges. There is several flower heads per plant, with deep purple disc florets but no ray florets.Graham’s thistle , Flora of North America, Cirsium grahamii A.Gray

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium grahamii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN335150.1 ↗585 bpUSA · 2002

ACGT

AGCCTGCACAGCAGAACGACCCGTGGACACGTAATCACAGCCGGGCGTCGAGGGGGTCGGGCGTCAGCCCGGTGCCCGCGATGCCTCGTC …

Cirsium grahamii voucher ARIZ 185 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Cirsium grahamii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 332×CCDB · ipcn-api-dl · TreeOfSex · plant

CCDB · ipcn-api-dl — Ownbey, G. B., P. H. Raven & D. W. Kyhos. 1975 [1976]. Chromosome numbers in some North American species of the genus Cirsium. III. Western United States, Mexico, and Guatemala. Brittonia 27(4): 297–304.

TreeOfSex · plant — Goldblatt1979 ↗

2n 321×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type91 records

Wild obs. + sensor18

Museum / vouchered73

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 5≤1 km 5≤10 km 2

12 georeferenced · 6 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 22≤1 km 14≤10 km 2

38 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	14
Flagstaff, US	13
Guasave, MX	10
Austin, US	10
Mexico City, MX	6
USFSlocation not on record	3
Riverside, US	3
Durango, MX	3
Saint Louis, US	3
Bronx, US	2
San Luis Obispo, US	2
Phoenix, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Giardini Botanici Hanburylocation not on record	1
Hazara Universitylocation not on record	1

15 institutions · 73 of 73 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)