Cirsium foliosum

(Hook.) DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records185

Data sources10

Biological traits84

DNA specimens2

eDNA detections1

Sources10 archives

Databases and archives Cirsium foliosum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility185 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources84 traits

Occurrence & distributionGBIF185 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Cirsium foliosum là một loài thực vật có hoa trong họ Cúc. Loài này được (Hook.) DC. mô tả khoa học đầu tiên năm 1838.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTUSDATRY

Size & morphology2

Plant height1.2 m

Seed mass3.02 mg

Life cycle & reproduction23

After harvest regrowth rateSlow

Bloom periodLate Spring

Coppice potentialNo

Flower colourwhite

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDARapid

Life spanperennial

Lifespan categoryModerate

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateModerate

Seedling vigorMedium

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment23

Active growth periodSummer

Adapted to coarse textured soilsNo

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourbrown

Growth formherb

Growth form USDASingle Crown

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min16 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry18

Anaerobic toleranceMedium

C:N ratioHigh

Caco3 toleranceLow

Cold stratification requiredNo

Drought toleranceNone

Fertility requirementMedium

Fire resistantNo

Fire toleranceHigh

Frost free days min80 days

Moisture useHigh

Nitrogen fixation levelNone

Precipitation max50 in

Precipitation min14 in

Salinity toleranceNone

Shade toleranceMedium

Soil pH max7.2 pH

Soil pH min6 pH

Temperature min-38 °F

Uses & economy13

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound150 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceMedium

Fruit seed conspicuousNo

Fruit seed persistenceNo

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium foliosum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG219192.1 ↗349 bpCanada · 2003

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Cirsium foliosum voucher CCDB-18322-G8 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cirsium foliosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidypolyploid inferred

Chromosome records34–342n range34median34mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 342×CCDB · book-ipcn73-74 · CCDB · eflora

CCDB · book-ipcn73-74 — GARDNER, R. C. 19 7 4 . Systematics of Cirsium (Compositae) in Wyoming. Madrono 22: 239-265.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type185 records

Wild obs. + sensor70

Museum / vouchered115

Origin

Native1

Range

Area of Occupancy AOO564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 42≤1 km 5≤10 km 5>10 km 5

57 georeferenced · 13 without coordinates

Open the mapobservation + sensor70

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 6≤1 km 7≤10 km 25>10 km 3

41 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence115

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pullman, US	29
University of Alberta Museumslocation not on record	11
Vancouver, CA	11
Pocatello, US	8
Victoria, CA	7
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	6
ASUlocation not on record	4
Moscow State Universitylocation not on record	3
Yukon Universitylocation not on record	3
Chongqing Museumlocation not on record	3
Boise, US	3
Chicago, US	2
Angwin, US	2
Claremont, US	2
Moscow, US	2
San Diego, US	1
Denver, US	1
Dekalb, US	1
Stockholm, SE	1
Missoula, US	1
Whitehorse, CA	1
Saint Louis, US	1
Corvallis, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Spearfish, US	1
WTUlocation not on record	1
Research Collection of B. A. Bennettlocation not on record	1
GB	1
Arizona State University Biocollectionslocation not on record	1
Portland, US	1
Bend, US	1
Austin, US	1

33 institutions · 114 of 115 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Cirsium foliosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.20 °C 7.20–7.20

Seasonal swing summer↔winter32.0 °C

Max temp (day)11.2 °C

Min temp (night)3.00 °C

Precipitation41.3 mm/mo

Air humidity60.0 %

Moisture balance0.4 mm/mo

Vapour deficit406 Pa

Wind speed2.50 m/s

Cloud cover54.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)