Cirsium erisithales

(Jacq.) Scop. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records26 230

Data sources12

Biological traits21

DNA specimens3

eDNA detections4

Sources12 archives

Databases and archives Cirsium erisithales's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility26 230 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Occurrence & distributionGBIF26 230 records

Environmental DNA2 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex1.1 Gbp

01Narrative

Leaf of Cirsium erisithales Cirsium erisithales, the yellow thistle or yellow melancholy thistle, is a perennial herbaceous plant in the tribe Cardueae within the family Asteraceae.Tropicos,Cirsium erisithales

No narrative description available for this taxon yet.

02Traits & measurements

SourcesLEDAGIFTWCVPTRY

Size & morphology4

Plant height0.975 m

Plant height max1.5 m

Plant height min0.5 m

Seed mass3.04 mg

Life cycle & reproduction6

Dispersal typewind

Flowering endSep

Flowering startJul

Life spanperennial

Lifespan years9 years

Raunkiær life formhemicryptophyte

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, forest edges, meadows, mountains, shrubberies, stony places

Woodinessnon-woody

Physiology & chemistry5

Leaf C:N ratio14.52 g/g

Leaf c459 mg/g

Leaf dry-matter content (LDMC)134 mg/g

Leaf n32.69 mg/g

Specific leaf area (SLA)34.46 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium erisithales has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences6

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKC969550.1 ↗643 bpItaly · 2012

ACGT

TCGAAGCCTGCACAGCAGAACGACCCGTGGACACGTAATCACAGCCGGGTGTCGAGGGGGTCGGGCGTGAGCCCGGTGCCCGCGATGCCT …

Cirsium erisithales internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Cirsium erisithales carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 110 169 714 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Cirsium erisithales1.11 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidy2× diploid · measured

Chromosome records34–682n range34median34mode21records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3420×GoaT · Tree of Sex Database · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +11

GoaT · Tree of Sex Database — ↗

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.

CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.

CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3858

CCDB · poland — Czapik R. 1958. Karyological studies in species of Cirsium Mill. em. Scop, occuring in Poland. Acta Soc. Bot. Pol. 27, 483-489.

CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.

CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.

CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.

CCDB · ipcn-api-dl — HINDAKOVA, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.

CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.

CCDB · book-ipcn73-74 — TALAVERA, S. 1974. Contribucion al estudio cariologico del genera Cirsium en la peninsula Iberica. Lagascalia 4: 285-296.

CCDB · kew — Bureš P, Wang Y-F, Horova L, Suda J. 2004. Genome size variation in Central European species of Cirsium (Compositae) and their natural hybrids. Annals of Botany 94: 353-363.

CCDB · Cave1958 — Czapik 1958

CCDB · Cave1962 — Baksay 1956

CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.

CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 583-587.

TreeOfSex · plant — Goldblatt1979 ↗

2n 681×CCDB · poland

CCDB · poland — Czapik R. 1958. Karyological studies in species of Cirsium Mill. em. Scop, occuring in Poland. Acta Soc. Bot. Pol. 27, 483-489.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type26 230 records

Wild obs. + sensor23 902

Museum / vouchered746

Cultivated / captive9

Other1 573

Origin

Introduced11

Range

Area of Occupancy AOO16 620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 3 005≤1 km 12 467≤10 km 5 018>10 km 148

20 638 georeferenced · 3 264 without coordinates

Open the mapobservation + sensor23 902

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 77≤1 km 140≤10 km 270>10 km 6

493 georeferenced · 253 without coordinates

Open the institutions mapphysical evidence746

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 9

9 georeferenced

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	123
GJOlocation not on record	97
GZUlocation not on record	95
BIO-UNIPIlocation not on record	91
BRNUlocation not on record	32
Provincia di Livornolocation not on record	20
LDlocation not on record	18
Institut und Museum fuer Geologie und Palaeontologielocation not on record	14
Adam Mickiewicz University in Poznańlocation not on record	14
Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record	13
Wlocation not on record	13
Salzburg, AT	12
Görlitz, DE	12
Bern, CH	12
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	8
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	7
BDBClocation not on record	7
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	5
Oskarshamn, SE	5
Porrentruy, CH	4
Berlin, DE	4
Zürich, CH	3
Bourges, FR	3
Karlsruhe, DE	2
Moscow State Universitylocation not on record	2
Fribourg, CH	2
MAlocation not on record	2
Davis, US	2
Dhaka, BD	2
CJBGlocation not on record	2
Bloomington, US	2
Canadian Department of Agriculturelocation not on record	1
Badajoz, ES	1
Saint Louis, US	1
Paris, FR	1
John May Museum of Natural Historylocation not on record	1
College of the Atlantic, Museumlocation not on record	1
Taipei, TW	1
Mlocation not on record	1
Uniwersytet Opolskilocation not on record	1
PRClocation not on record	1
Macomb, US	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1
ULBF-AGRlocation not on record	1
Xiamen, CN	1

45 institutions · 642 of 746 vouchered records shown · 96 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Cirsium erisithales was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.00 °C 4.60–13.4

Seasonal swing summer↔winter20.0 °C

Max temp (day)13.3 °C 8.90–17.7

Min temp (night)4.40 °C 0.5–8.30

Precipitation74.0 mm/mo 72.6–75.4

Air humidity60.1 % 58.6–61.6

Moisture balance1.80 mm/mo -16.1–19.7

Vapour deficit541 Pa 349–734

Wind speed3.40 m/s 2.80–4.10

Cloud cover43.1 % 41.3–45.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cirsium erisithales

At a glance

Sources12 archives

Size & morphology4

Life cycle & reproduction6

Habitat & environment6

Physiology & chemistry5

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type26 230 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions19 of 45 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type26 230 records