Cirsium eatonii

(A.Gray) B.L.Rob. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records264

Data sources10

Biological traits13

DNA specimens5

eDNA detections2

Sources10 archives

Databases and archives Cirsium eatonii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility264 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF264 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Cirsium eatonii, commonly known as Eaton's thistle or mountaintop thistle, is a North American species of flowering plants in the family Asteraceae. The species has been found in Idaho, Montana, New Mexico, Wyoming, Nevada, Utah and Colorado.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Seed mass5.16 mg

Seed mass max5.16 mg

Seed mass min5.16 mg

Life cycle & reproduction2

Life spanperennial

⚠ sources differ — TRY: perennial · GIFT: biennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium eatonii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes6

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN604604.1 ↗565 bpUSA · 2005

ACGT

CCCGTGGACACGTAATCACAGCCGGGCGTCGAGGGGGTCGGGCGTCAGCCCGGTGCCCGCGATGCCTCGTCGACGTGCGTCCGCGATGCC …

Cirsium eatonii var. murdockii voucher BRY 478715 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL1★trnL-F★ITS4★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Cirsium eatonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome records34–342n range34median34mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 346×CCDB · book-ipcn65 · CCDB · book-ipcn67-71 · CCDB · eflora +1

CCDB · book-ipcn65 — Moore & F. 1965

CCDB · book-ipcn67-71 — OWNBEY, G.B., & Y-T. HSI. 1969. Chromosome numbers in some North American species of the genus Cirsium. II. Western United states. Madrono 20: 225-228.

CCDB · eflora

CCDB · Cave1963 — Moore & Frank. 1963

n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Chambers, K. L., D. Green, S. Potampa & L. McMahan. 1998. IOPB chromosome data 13. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 29: 18–22.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type264 records

Wild obs. + sensor95

Museum / vouchered169

Range

Area of Occupancy AOO716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 52≤1 km 10≤10 km 3>10 km 3

68 georeferenced · 27 without coordinates

Open the mapobservation + sensor95

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 19≤1 km 44≤10 km 26>10 km 2

91 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence169

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Colonial National Historical Parklocation not on record	54
Bronx, US	27
Pocatello, US	9
BClocation not on record	9
Chicago, US	7
Moscow, US	6
Provo, US	6
Logan, US	5
Musee des Dinosaures d'Esperaza (Aude)location not on record	5
Bozeman, US	4
Claremont, US	4
Denver, US	3
Saint Louis, US	3
Riverside, US	3
Canadian Department of Agriculturelocation not on record	3
Durango, US	3
San Luis Obispo, US	2
Orem, US	2
Bangkok, TH	2
CASlocation not on record	1
San Francisco, US	1
New Mexico Museum of Natural History and Sciencelocation not on record	1
Rocky Mountain Biological Laboratorylocation not on record	1
Missoula, US	1
Portland, US	1
Pittsburg, US	1
Angwin, US	1
ASUlocation not on record	1
Grand Junction, US	1
DOI/NPS, Greenbelt Parklocation not on record	1

30 institutions · 168 of 169 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Cirsium eatonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

No winter annuals seen. Absaroka volcanics w…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 13.8–13.8

Seasonal swing summer↔winter25.1 °C

Max temp (day)21.0 °C

Min temp (night)6.40 °C

Precipitation81.7 mm/mo

Air humidity48.7 %

Moisture balance-71.1 mm/mo

Vapour deficit815 Pa

Wind speed1.60 m/s

Cloud cover24.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)