Cirsium creticum

(Lam.) d'Urv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records169

Data sources9

Biological traits11

DNA specimens1

eDNA detections0

Sources9 archives

Databases and archives Cirsium creticum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility169 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF169 records

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · TreeOfSex2n = 34

01Narrative

Cirsium creticum ist eine Pflanzenart aus der Gattung der Kratzdisteln (Cirsium) in der Familie der Korbblütler (Asteraceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology2

Plant height0.4 m

Seed mass1.38 mg

Life cycle & reproduction3

Life spanbiennial

Lifespan years1 years

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: perennial forb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium creticum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN335081.1 ↗632 bpTurkey

ACGT

AGCCTGCACAGCAGAACGACCCGTGGACACGTAATCACAGCCGGGCGTCAGGGGGTCGGGCGTGAGCCCGGTGCCCGCGATGCCTCGTCG …

Cirsium creticum voucher DK__Cirsium_creticum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Cirsium creticum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome records34–342n range34median34mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 346×CCDB · ita-fl · CCDB · mediterranean · CCDB · ipcn-api-dl +1

CCDB · ita-fl — PAVONE P., TERRASI M.C., ZIZZA A. - 1981. Chromosome number reports LXXII.. Taxon , 30(3): 695-696.

CCDB · mediterranean

CCDB · ipcn-api-dl — Kuzmanova, B., S. Georgieva & V. Nikolova. 1979a. In IOPB chromosome number reports LXIV. Taxon 28:408.

CCDB · ipcn-api-dl — Pavone, P., C. M. Terrasi & A. Zizza. 1981. In Chromosome number reports LXXII. Taxon 30: 695–696.

CCDB · ipcn-api-dl — Snogerup, S. 1995. Mediterranean chromosome number reports 5 (491--517). Fl. Medit. 5: 331–334.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type169 records

Wild obs. + sensor27

Museum / vouchered141

Other1

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 16≤1 km 2≤10 km 1>10 km 1

20 georeferenced · 7 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 2≤1 km 4≤10 km 14>10 km 1

21 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence141

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	63
LDlocation not on record	44
GJOlocation not on record	18
BIO-UNIPIlocation not on record	4
Davis, US	2
Moscow State Universitylocation not on record	1
MAlocation not on record	1
Dresden, DE	1
Stockholm, SE	1
Provincia di Livornolocation not on record	1
Wlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
PRClocation not on record	1
València, ES	1
Adam Mickiewicz University in Poznańlocation not on record	1

15 institutions · 141 of 141 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)