Cirsium carolinianum

(Walter) Fernald & Schub. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records547

Data sources13

Biological traits11

DNA specimens1

eDNA detections1

Sources13 archives

Databases and archives Cirsium carolinianum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility547 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Chemical compositionLOTUS · NPASS26 compounds

Occurrence & distributionGBIF547 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Cirsium carolinianum is a North American species of plants in the tribe Cardueae within the family Asteraceae. Common name is Carolina thistle or purple thistle or soft thistle or smallhead thistle. The species is native to the central and southern United States, from eastern Texas east to Virginia and the Carolinas, north to the Ohio Valley.Biota of North America Program 2014 county distribution map Cirsium carolinianum is a biennial herb up to 180 cm (6 feet) tall, with a relatively short taproot. Leaves have small, thin spines along the edge, much smaller than those of related species. There are usually several flower heads, with pinkish-purple (rarely white) disc florets but no ray florets.Flora of North America, Carolina or purple or soft or smallhead thistle, Cirsium carolinianum (Walter) Fernald & B. G. Schubert. Flowers bloom April to July. Its habitats include wooded areas, fields, and roadsides.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass2.7 mg

Seed mass max2.7 mg

Seed mass min2.7 mg

Life cycle & reproduction2

Life spanbiennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition26 compounds

Compounds documented for Cirsium carolinianum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols5

Ursane and Taraxastane triterpenoids3

Flavones3

Plant xanthones3

Stigmastane steroids2

Documented compounds26 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Dehydrocostus lactone	present	LOTUS
(1R,4aS,6aR,6aR,6bR,8aR,10S,12aR,14aR,14bS)-10-hydroxy-1,6a,6b,9,9,12a-hexamethyl-2-methylidene-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14,14a,14b-hexadecahydropicene-4a-carboxylic acid	present	NPASS
(3aS,6aR,9aR,9bS)-6,9-dimethylidene-3a,4,5,6a,7,8,9a,9b-octahydro-3H-azuleno[4,5-b]furan-2-one	present	LOTUS
1,3,7-Trihydroxyxanthone	present	NPASS
1,3-dihydroxy-5-methoxy-9H-xanthen-9-one	present	NPASS
3,4,5-Trihydroxyxanthen-9-One	present	NPASS
4-Hydroxy-2,3-dimethoxyxanthone	present	NPASS
6-Methylscutellarein	present	LOTUS
Apigenin	present	LOTUS
beta-Sitosterol	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium carolinianum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN335109.1 ↗633 bpUSA · 2014

ACGT

AGCCTGCACAGCAGAACGACCCGTGGACACGTAATCACAGCCGGGCGTCGAGGGGGTCGGGCGTCAGCCCGGTGCCGCGATGCCTCGTCG …

Cirsium carolinianum voucher USCH internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cirsium carolinianum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — OWNBEY, G.B., & W.A. OLSON. 1969. Cytotaxonomic notes on the species of Cirsium native to the Southeastern United States. Rhodora 71: 285-296.

n 111×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — JONES, S.B., JR. 1970. Chromosome numbers in Compositae. Bull. Torrey Bot. Club. 97: 168-174.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type547 records

Wild obs. + sensor397

Museum / vouchered149

Other1

Origin

Native1

Range

Area of Occupancy AOO1 528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 224≤1 km 28≤10 km 10>10 km 73

335 georeferenced · 62 without coordinates

Open the mapobservation + sensor397

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 9≤1 km 12≤10 km 31>10 km 10

62 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence149

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	21
Bronx, US	19
Chicago, US	13
Jackson, US	10
Tuscaloosa, US	10
Wuzhou, CN	7
Fayetteville, US	6
Mississippi State, US	5
US	5
Little Rock, US	5
Bloomington, US	4
Fort Worth, US	4
AUAlocation not on record	4
Austin, US	3
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	3
Henderson State Universitylocation not on record	3
Chongqing Museumlocation not on record	2
EL PASO, US	2
Bangkok, TH	2
Chapel Hill, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Johnson City, US	1
University of Stellenboschlocation not on record	1
Durango, MX	1
Knoxville, US	1
Columbia, US	1
DOI/NPS, Selma to Montgomery National Historic Traillocation not on record	1
Springfield, US	1
Chadron, US	1
San Angelo, US	1
Fairfax, US	1
Conway, US	1
GB	1
Richmond, US	1
Anton de Kom University of Surinamelocation not on record	1
University of Southern Mississippilocation not on record	1
Conway, US	1
LINUlocation not on record	1

38 institutions · 149 of 149 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Cirsium carolinianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)