Cirsium brachycephalum

Jur. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cirsium

At a glance

Occurrence records567

Data sources10

Biological traits14

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Cirsium brachycephalum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility567 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources14 traits

Occurrence & distributionGBIF567 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 34

01Narrative

Cirsium brachycephalum is a species of flowering plant belonging to the family Asteraceae. Its native range is Eastern Central and Southeastern Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology6

Plant height1.2 m

Plant height max1 m

Plant height min0.5 m

Seed mass0.63 mg

Seed mass max0.63 mg

Seed mass min0.63 mg

Life cycle & reproduction4

Flowering endSep

Flowering startJun

Life spanvariable

Raunkiær life formhemicryptophyte

Habitat & environment2

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)142 mg/g

Specific leaf area (SLA)15.7 mm²/mg

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium brachycephalum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSMN918921.1 ↗656 bp

ACGT

ATCATTGTCGAAGCCTGCACAGCAGAACGACCCGTGAACACGTAATCACAGCCGGGCGTCGAGGGGGTCGGGCGTTAGCCCGGTGCCCGC …

Cirsium brachycephalum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Cirsium brachycephalum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome records34–342n range34median34mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 348×GoaT · Tree of Sex Database · CCDB · slov-fl · CCDB · ipcn-api-dl +2

GoaT · Tree of Sex Database — ↗

CCDB · slov-fl — Murín A., Svobodová Z., Májovský J. & Feráková V., 1999: Chromosome numbers of some species of the Slovak flora. - Thaiszia - J. Bot., Košice 9/1: 31-40.

CCDB · slov-fl — Murín A. & Svobodová Z., 1992: Karyological study of the Slovak flora XXVI. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 59-62.

CCDB · slov-fl — Murín A. & Májovský J., 1983: Karyological study of Slovakian flora IV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 30: 1-16.

CCDB · ipcn-api-dl — Murín, A. & Z. Svobodová. 1992. Karyological study of the Slovak flora XXVI. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 39: 59–65.

CCDB · ipcn-api-dl — Murín, A., Z. Svobodová, J. Májovský & V. Feráková. 1999. Chromosome numbers of some species of the Slovak flora. Thaiszia 9(1): 31–40.

CCDB · kew — Bureš P, Wang Y-F, Horova L, Suda J. 2004. Genome size variation in Central European species of Cirsium (Compositae) and their natural hybrids. Annals of Botany 94: 353-363.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type567 records

Wild obs. + sensor413

Museum / vouchered128

Other26

Range

Area of Occupancy AOO972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 150≤1 km 37≤10 km 8>10 km 4

199 georeferenced · 214 without coordinates

Open the mapobservation + sensor413

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 9≤1 km 33≤10 km 48

90 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence128

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BRNUlocation not on record	51
GZUlocation not on record	18
GJOlocation not on record	14
LDlocation not on record	12
Wlocation not on record	8
Provincia di Livornolocation not on record	7
Görlitz, DE	4
Oskarshamn, SE	3
Salvador, BR	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Mlocation not on record	1
Salzburg, AT	1
MAlocation not on record	1
BClocation not on record	1
Uppsala, SE	1
Adam Mickiewicz University in Poznańlocation not on record	1

16 institutions · 128 of 128 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)