Cirsium arvense
(L.) Scop. · speciesAt a glance
Occurrence records1 338 837
Data sources15
Biological traits75
DNA specimens119
eDNA detections160
Sources15 archives
Databases and archives Cirsium arvense's data was compiled from.
WikipediaWikimedia Foundation14 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 338 837 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI160 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics119 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources75 traits
Chemical compositionLOTUS · NPASS59 compounds
Occurrence & distributionGBIF1 338 837 records
Environmental DNA2 datasets · 16 countries160 detections
DNA & barcodingBOLD · NCBI119 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex1.5 Gbp
01Narrative
Cirsium arvense is a perennial species of flowering plant in the family Asteraceae, native throughout Europe and western Asia, northern Africa and widely introduced elsewhere.Joint Nature Conservation Committee: Cirsium arvensehttp://www.efloras.org/florataxon.aspx?flora_id=2&taxon_id=200023656 Flora of China, 丝路蓟 si lu ji, Cirsium arvense (Linnaeus) Scopoli]Altervista Flora Italiana, Cardo dei campi comune, Acker-Kratzdistel, åkertistel, Cirsium arvense (L.) Scop. includes photos and distribution maps The standard English name in its native area is creeping thistle.Botanical Society of Britain and Ireland Database It is also commonly known as Canada thistle and field thistle.Flora of North America, Canada or creeping or field thistle, chardon du Canada ou des champs, cirse des champs, Cirsium arvense (Linnaeus) ScopoliNebraska Department of Agriculture Noxious Weed Program The plant is beneficial for pollinators that rely on nectar. It also was a top producer of nectar sugar in a 2016 study in Britain, with a second-place ranking due to a production per floral unit of ().
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology30
Fruit length3 mm
⚠ sources differ — AusTraits: 3 mm · GIFT: 3.62 mm
Fruit length max4.5 mm
Fruit length min3 mm
Fruit width1.15 mm
Fruit width max1.5 mm
Fruit width min1 mm
Leaf length40 mm
⚠ sources differ — AusTraits: 40 mm · GIFT: 100 mm
Leaf length max170 mm
Leaf length min70 mm
Leaf mass184 mg
Leaf size1 401 mm²
⚠ sources differ — TRY: 1 401 mm² · LEDA: 3 858 mm² · GIFT: 3 858 mm²
Leaf width37.5 mm
Leaf width max100 mm
Leaf width min15 mm
Plant height0.721 m
⚠ sources differ — GIFT: 0.721 m · AusTraits: 1 m · LEDA: 0.863 m · TRY: 0.825 m
Plant height generative0.879 m
Plant height max1.5 m
Plant height min0.2 m
Seed length3.39 mm
Seed length max3.5 mm
Seed length min3.5 mm
Seed mass1.33 mg
⚠ sources differ — TRY: 1.33 mg · LEDA: 1.24 mg · GIFT: 1.5 mg
Seed mass max2.13 mg
Seed mass min0.8 mg
Seed volume2 mm³
Seed volume max2 mm³
Seed volume min2 mm³
Seed width1.3 mm
Seed width max1.3 mm
Seed width min1.3 mm
Life cycle & reproduction16
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endSep
Flowering startJul
Flowering timeyynnnnnnnnny
Life formperennial
Life spanperennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
⚠ sources differ — LEDA: Geophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number5 000
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 300 m
Elevation mean1 846 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTcanals, crop fields
Leaf compoundnesssimple
Leaf shapelanceolate oblanceolate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry10
Leaf C:N ratio20.88 g/g
Leaf c423 mg/g
Leaf dry-matter content (LDMC)176 mg/g
⚠ sources differ — TRY: 176 mg/g · LEDA: 153 mg/g
Leaf n22.37 mg/g
Leaf p1.81 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)18.81 mm²/mg
⚠ sources differ — TRY: 18.81 mm²/mg · LEDA: 14.95 mm²/mg · GIFT: 15.4 mm²/mg
Wood density206 mg/cm³
Other traits2
Diaspore typegerminule
Seeds per fruit>1000
03Chemical composition59 compounds
Compounds documented for Cirsium arvense across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Macrolide lactones12
Flavones12
Cytochalasan alkaloids10
Hydrocarbons5
Oxygenated hydrocarbons3
Documented compounds59 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1E,5R,10S,11S,14S)-4-ethyl-10,14-dihydroxy-5-[(1S)-1-hydroxyethyl]-11-methoxy-12-oxa-4-azatricyclo[9.2.1.02,5]tetradec-1-en-3-one | present | LOTUS | |
| (1E,5R,11S,12S,15S)-4-ethyl-11,15-dihydroxy-12-methoxy-5-methyl-13-oxa-4-azatricyclo[10.2.1.02,5]pentadec-1-en-3-one | present | NPASS | |
| (1E,5R,9S,10S,13S)-4-ethyl-9,13-dihydroxy-10-methoxy-5-methyl-11-oxa-4-azatricyclo[8.2.1.02,5]tridec-1-en-3-one | present | LOTUS | |
| (1E,7S,12S,13S,16S)-12,16-dihydroxy-13-methoxy-4,7-dimethyl-14-oxa-4-azatricyclo[11.2.1.02,7]hexadec-1-ene-3,8-dione | present | LOTUS | |
| (1R,3Z,6S,7R,8S,9R,10R,16R,18E,20R,21S,23S,24R,25S)-25-benzyl-7,8,21-trihydroxy-10-methoxy-16,23-dimethyl-22-methylidene-2,12,27-trioxo-26-azapentacyclo[18.7.0.01,24.05,11.06,9]heptacosa-3,5(11),18-triene-6-carboxamide | present | LOTUS | |
| (1S,2R,7S,8E,10R)-7-hydroxy-2-methyl-3,11-dioxabicyclo[8.1.0]undec-8-en-4-one | present | LOTUS | |
| (1S,4E,6R,12E,14S,15S,17R,18S,19S,20S)-20-benzyl-6-hydroxy-17,18-dimethyl-2,16-dioxa-21-azatetracyclo[12.8.0.01,19.015,17]docosa-4,12-diene-3,22-dione | present | LOTUS | |
| (1S,4Z,7S,8R,9R,10R,11S,17R,19E,21S,22S,24S,25S,26S)-26-benzyl-8,9,22-trihydroxy-11-methoxy-17,24-dimethyl-23-methylidene-3,13,28-trioxo-2-oxa-27-azapentacyclo[19.7.0.01,25.06,12.07,10]octacosa-4,6(12),19-triene-7-carboxamide | present | LOTUS | |
| (1Z,6E)-gamma-humulene | present | LOTUS | |
| (2-Hexanoyloxy-3-tetradecanoyloxypropyl) tetradecanoate | present | LOTUS |
05DNA & barcoding119 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirsium arvense has left across the world's sequence archives.
At a glance
DNA specimens119
Marker genes10
GenBank sequences10
eDNA detections160
Countries16
The DNA barcodea real sequence read deposited for this species
CGCATCGCGTCGCACCAGACCATGCCTCCCCAACGGGGATGCGTCTGTCTGGAGCGGAGAATGGTCTCCCGTGTCGTTGGCGCGGTTGGC …
Cirsium arvense var. integrifolium voucher JN-3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★trnL-F★ITS5★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Cirsium arvense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 545 240 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cirsium arvense1.55 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 34 n = 17
Ploidydiploid inferred
Chromosome records28–682n range34median34mode90records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3484×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Tree of Sex Database · CCDB · slov-fl +19
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Tree of Sex Database — ↗
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · iapt
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · iber-fl — Contribucin al estudio cariolgico del gnero Cirsium en la pennsula Ibrica. Talavera, S.Lagascalia4(2): 285-296(1974).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3863
CCDB · fl-europaea — Majovsky et al.,
CCDB · poland — ?abi?ska D. 1977. Embryology of the dioecious species Cirsium arvense (L.) Scop. Acta Biol. Cracov. Ser. Bot. 20, 133-146.
CCDB · poland — Czapik R. 1958. Karyological studies in species of Cirsium Mill. em. Scop, occuring in Poland. Acta Soc. Bot. Pol. 27, 483-489.
CCDB · poland — Skali?ska M., Ma?ecka J., Izmai?ow R. et al. 1974. Further studies in chromosome numbers of Polish Angiosperms. Tenth contribution. Acta Biol. Cracov. Ser. Bot. 17, 133-163.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Tonian, T. R. 1981a. Cariological data on species of Cirsium Mill. growing in Armenia. Biol. Zurn. Armen. 34 (7): 769–772. (In Russian).
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.
CCDB · ipcn-api-dl — Sidhu, M. K. 1979. Distributional and cytological studies of the weed flora of cultivable fields of Patiala district (Panjab). Ph.D. Thesis, Patiala. 1-230. 1979.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · ipcn-api-dl — Van Den Brand, C., F. C. M. V. Meel & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 395–397.
CCDB · ipcn-api-dl — Kuzmanov, B., S. Georgieva, V. Nikolova & I. Penceva. 1981a. In Chromosome number reports LXXII. Taxon 30: 701–702.
CCDB · ipcn-api-dl — Skalinska, M. 1974. Further studies in chromosome numbers of Polish angiosperms. X. Acta Biol. Cracov., Ser. Bot. 17: 133–164.
CCDB · ipcn-api-dl — Uhrikova, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.
CCDB · ipcn-api-dl — Xu, B. s., R. f. Weng & M. z. Zhang. 1992. Chromosome numbers of Shanghai plants I. Invest. Stud. Nat. 12: 48–65.
CCDB · ipcn-api-dl — Yan, B. h. & Z. t. Yin. 1995. Chromosome studies of 2 species of Cirsium. Guihaia 15(2): 172–175.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — Nishikawa, T. 1984. Chromosome counts of flowering plants of Hokkaido (7). J. Hokkaido Univ. Educ., Sect. 2B 35: 31–42.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn67-71 — MOORE, R.J. 1968. In IOPB chromosome number reports XVIII. Taxon 17: 419-422.
CCDB · book-northern-plants — Ehrenberg 1945.
+33 more references
2n 685×CCDB · poland · CCDB · ipcn-api-dl · CCDB · CromoCat 2015 +1
CCDB · poland — Czapik R. 1958. Karyological studies in species of Cirsium Mill. em. Scop, occuring in Poland. Acta Soc. Bot. Pol. 27, 483-489.
CCDB · ipcn-api-dl — Kuzmanov, B., S. Georgieva, V. Nikolova & I. Penceva. 1981a. In Chromosome number reports LXXII. Taxon 30: 701–702.
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, M. (1991). Kariologicno izsledvane na balgarski Sloznocvetni. IV. Tribus Carduae Cass. Fitologija 39: 3-22.
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S., Nikolova, V. & Penceva, I. (1981c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 701-702.
TreeOfSex · plant — Goldblatt1979 ↗
2n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Ghaffari. (2006). New or rare chromosome counts of some angiosperm species from Iran II. Iran. J. Bot. 12(1): 81–86.
CCDB · CromoCat 2015 — Gupta, R. C. & Gill, B. S. (1989). Cytopalynology of north and central Indian Compositae J. Cytol. Genet. 24: 96-105.
2n 281×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.
2n 511×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
n 177×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015 +1
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Kuzmanov, B., S. Georgieva, V. Nikolova & I. Penceva. 1981a. In Chromosome number reports LXXII. Taxon 30: 701–702.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · CromoCat 2015 — Laane, M. M. (1969a). Further chromosome studies in Norwegian vascular plants. Blyttia 27: 5-17.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
CCDB · CromoCat 2015 — Gupta, R. C. & Gill, B. S. (1989). Cytopalynology of north and central Indian Compositae J. Cytol. Genet. 24: 96-105.
TreeOfSex · plant — Goldblatt1979 ↗
n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Laane, M. M. (1969a). Further chromosome studies in Norwegian vascular plants. Blyttia 27: 5-17.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~5.73 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin5.73 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type1 338 837 records
Wild obs. + sensor1 306 999
Museum / vouchered26 480
Cultivated / captive1 528
Fossil1
Other3 829
Origin
Native58 219
Introduced6 248
Range
Area of Occupancy AOO987 684 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy52% within 1 km
≤100 m 294 710≤1 km 255 585≤10 km 502 414>10 km 7 347
1 060 056 georeferenced · 246 943 without coordinates
Open the mapobservation + sensor1 306 999
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 1 300≤1 km 6 821≤10 km 11 692>10 km 541
20 354 georeferenced · 6 126 without coordinates
Open the institutions mapphysical evidence26 480
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 3>10 km 23
26 georeferenced · 1 502 without coordinates
Open the mapnot free-living1 528
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions205 of 373 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 14 345 |
| BFLlocation not on record | 667 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 428 |
| BIO-UNIPIlocation not on record | 420 |
| Moscow State Universitylocation not on record | 397 |
| LDlocation not on record | 303 |
| Salzburg, AT | 294 |
| Olocation not on record | 263 |
| Bronx, US | 231 |
| St. Paul, US | 222 |
| Uniwersytet Warszawskilocation not on record | 211 |
| Görlitz, DE | 209 |
| MeiseBGlocation not on record | 201 |
| Madison, US | 195 |
| South Kensington, GB | 192 |
| Philadelphia, US | 190 |
| Wuzhou, CN | 184 |
| Kuopio, FI | 171 |
| Oulu, FI | 166 |
| Oregon State Universitylocation not on record | 157 |
| Karlsruhe, DE | 151 |
| GMBAlocation not on record | 116 |
| Chicago, US | 111 |
| Vancouver, CA | 109 |
| TROMlocation not on record | 107 |
| Chongqing Museumlocation not on record | 107 |
| Garðabær, IS | 106 |
| Berlin, DE | 102 |
| GJOlocation not on record | 100 |
| Oskarshamn, SE | 99 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 98 |
| Christchurch, NZ | 98 |
| Bergen, NO | 97 |
| Denver, US | 97 |
| Trondheim, NO | 93 |
| SLU Artdatabankenlocation not on record | 91 |
| Canadian Department of Agriculturelocation not on record | 91 |
| Turku, FI | 88 |
| WTUlocation not on record | 83 |
| Adam Mickiewicz University in Poznańlocation not on record | 83 |
| Pullman, US | 82 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 80 |
| Québec, CA | 70 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 68 |
| Ann Arbor, US | 67 |
| Corvallis, US | 62 |
| València, ES | 59 |
| GZUlocation not on record | 59 |
| Bloomington, US | 58 |
| Saint John, CA | 58 |
| Jyväskylä, FI | 56 |
| Université Lavallocation not on record | 55 |
| Provincia di Livornolocation not on record | 54 |
| University of Wisconsinlocation not on record | 53 |
| Chadron, US | 53 |
| MAlocation not on record | 52 |
| BDBClocation not on record | 52 |
| Bern, CH | 51 |
| QAUlocation not on record | 51 |
| Acadia Universitylocation not on record | 50 |
| University of Alberta Museumslocation not on record | 50 |
| WINlocation not on record | 49 |
| Montréal, CA | 47 |
| Moscow, US | 46 |
| Pamplona, ES | 45 |
| Entomological Society of Latvialocation not on record | 45 |
| New Brunswick, US | 45 |
| McWane Science Centerlocation not on record | 45 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 44 |
| KMNlocation not on record | 43 |
| Barcelona, ES | 42 |
| BRNUlocation not on record | 40 |
| Burlington, US | 38 |
| Missoula, US | 38 |
| Saint Louis, US | 38 |
| Vitoria, ES | 37 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 36 |
| Beijing, CN | 34 |
| University of New Hampshirelocation not on record | 33 |
| Bozeman, US | 32 |
| Wlocation not on record | 32 |
| Uppsala, SE | 31 |
| Green Bay, US | 30 |
| Auckland, NZ | 30 |
| DOI/NPS, Greenbelt Parklocation not on record | 30 |
| Spearfish, US | 29 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 29 |
| Allentown, US | 29 |
| University of Stellenboschlocation not on record | 29 |
| Pocatello, US | 28 |
| Mlocation not on record | 28 |
| UGentlocation not on record | 27 |
| BClocation not on record | 26 |
| Provo, US | 24 |
| 24 | |
| Yangling, CN | 24 |
| Tallinn, EE | 23 |
| Millersville, US | 23 |
| Brookings, US | 22 |
| San Sebastián, ES | 22 |
| College Park, US | 22 |
| TUR-Alocation not on record | 22 |
| Riverside, US | 21 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 20 |
| Madrid, ES | 20 |
| New Haven, US | 20 |
| Davis, US | 19 |
| Whitewater, US | 19 |
| Frankfurt am Main | 19 |
| Fargo, US | 19 |
| Logan, US | 18 |
| Flagstaff, US | 18 |
| Urumqi, CN | 18 |
| Arcata, US | 18 |
| Toronto, CA | 17 |
| Porvoo, FI | 17 |
| Albuquerque, US | 17 |
| Salamanca, ES | 15 |
| Palacký University in Olomouclocation not on record | 15 |
| Dekalb, US | 15 |
| Helsinki, FI | 14 |
| Granada, ES | 14 |
| Wellington, NZ | 14 |
| Jiangxi College of Educationlocation not on record | 14 |
| Jaén, ES | 14 |
| Caldwell, US | 14 |
| Williamsburg, US | 14 |
| Minia, EG | 14 |
| CJBGlocation not on record | 13 |
| Pamplona, ES | 13 |
| Victoria, CA | 13 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 12 |
| College of the Atlantic, Museumlocation not on record | 12 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| Portland, US | 12 |
| CICYTEXlocation not on record | 11 |
| Porrentruy, CH | 11 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 11 |
| Uniwersytet Śląski w Katowicachlocation not on record | 11 |
| Staten Island, US | 11 |
| Bangkok, TH | 11 |
| IDElocation not on record | 11 |
| Anchorage, US | 10 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 10 |
| Lanzhou, CN | 10 |
| San Luis Obispo, US | 10 |
| Mount Annan, AU | 10 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| Zürich, CH | 10 |
| Uniwersytet Opolskilocation not on record | 9 |
| Museo Entomologico de Leonlocation not on record | 9 |
| Chapel Hill, US | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| Boise, US | 9 |
| Phyletisches Museum Jenalocation not on record | 9 |
| Kew, GB | 8 |
| Alicante, ES | 8 |
| Rotorua, NZ | 8 |
| Claremont, US | 8 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 8 |
| Philadelphia, US | 8 |
| CASlocation not on record | 7 |
| Tilburg, NL | 7 |
| WNNUlocation not on record | 7 |
| Bourges, FR | 7 |
| Chicago, US | 7 |
| Museum of the Rockieslocation not on record | 7 |
| Angwin, US | 7 |
| Dresden, DE | 7 |
| Mount Pleasant, US | 7 |
| Pittsburg, US | 7 |
| Inner Mongolia Universitylocation not on record | 6 |
| Tartu, EE | 6 |
| Morgantown, US | 6 |
| Chicago, US | 6 |
| Podgorica, ME | 6 |
| Tula State Universitylocation not on record | 6 |
| Museo Achille Folettolocation not on record | 6 |
| Lincoln, US | 6 |
| OLAlocation not on record | 6 |
| USFS/BHSClocation not on record | 6 |
| BSBIlocation not on record | 6 |
| SZUlocation not on record | 6 |
| Orem, US | 6 |
| Austin, US | 5 |
| University of Lethbridgelocation not on record | 5 |
| SIHUlocation not on record | 5 |
| Paris, FR | 5 |
| PrivatHerblocation not on record | 5 |
| ASUlocation not on record | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| Whitehorse, CA | 5 |
| QVMAGlocation not on record | 5 |
| Otaru, JP | 5 |
| Durango, US | 5 |
| Rovaniemi, FI | 5 |
| Cheney, US | 5 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 5 |
| Emporia, US | 4 |
| Waverly, US | 4 |
| DBF-NHMDlocation not on record | 4 |
| Stockholm, SE | 4 |
| Hudson, US | 4 |
| Eastern Nevada Landscape Coalitionlocation not on record | 4 |
| Tromso University Museumlocation not on record | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Royal Botanical Gardenslocation not on record | 4 |
| Santa Barbara, US | 4 |
| Johnson City, US | 4 |
| Davenport, US | 4 |
| DASSHlocation not on record | 4 |
| Northridge, US | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| KIRMlocation not on record | 4 |
| Badajoz, ES | 4 |
| Bandelier National Monumentlocation not on record | 4 |
| Xiamen, CN | 4 |
| EL PASO, US | 4 |
| Frauenfeld, CH | 4 |
| JBSlocation not on record | 3 |
| Philadelphia, US | 3 |
| Xining, CN | 3 |
| Macomb, US | 3 |
| Zürich, CH | 3 |
| Science Museum of Minnesotalocation not on record | 3 |
| Rocky Mountain Biological Laboratorylocation not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| SWlocation not on record | 3 |
| Minot State Universitylocation not on record | 3 |
| Córdoba, ES | 3 |
| Keene State Universitylocation not on record | 3 |
| Hunan Geological Museumlocation not on record | 3 |
| VALElocation not on record | 3 |
| UIBlocation not on record | 3 |
| Coimbra, PT | 3 |
| San Diego, US | 3 |
| Glarus, CH | 3 |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| Fairfax, US | 3 |
| Ashland, US | 3 |
| Ypsilanti, US | 3 |
| Columbia, US | 3 |
| Tempe, US | 3 |
| University of British Columbialocation not on record | 2 |
| US | 2 |
| EEZA-CSIClocation not on record | 2 |
| Tacoma, US | 2 |
| ISAlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| Brisbane, AU | 2 |
| BGBMlocation not on record | 2 |
| HJAEFlocation not on record | 2 |
| Oswego, US | 2 |
| US | 2 |
| Mississippi State, US | 2 |
| nbflocation not on record | 2 |
| Kushiro City Museumlocation not on record | 2 |
| Washington, US | 2 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 2 |
| Pretoria, ZA | 2 |
| cslocation not on record | 2 |
| Hobart, AU | 2 |
| Ivano-Frankove, UA | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Grand Junction, US | 2 |
| Sion, CH | 2 |
| B.A. Bennett Herbariumlocation not on record | 2 |
| Turlock, US | 2 |
| Göteborg, SE | 2 |
| National Museum Waleslocation not on record | 2 |
| Sevilla, ES | 2 |
| LPMMBHlocation not on record | 2 |
| Chiba, JP | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Miami, US | 2 |
| Peking Universitylocation not on record | 2 |
| Hamilton, US | 2 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 2 |
| Kunming, CN | 2 |
| Winterthur, CH | 2 |
| Kathmandu, NP | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 2 |
| Phoenix, US | 2 |
| Salvador, BR | 2 |
| Harrisonburg, US | 2 |
| Palmerston North, NZ | 2 |
| Tomioka, JP | 2 |
| Dehra Dun, IN | 2 |
| Fribourg, CH | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| ESP003location not on record | 1 |
| LfUlocation not on record | 1 |
| University of South Dakotalocation not on record | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| Irvine, US | 1 |
| Mexico City, MX | 1 |
| Gijón, ES | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| SVN019location not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Clemson, US | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Portland, US | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Dover, US | 1 |
| USFSlocation not on record | 1 |
| AUAlocation not on record | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| Chongqing, CN | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| Bothell, US | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| SEFlocation not on record | 1 |
| Nagano City, JP | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Portland, US | 1 |
| Durham, US | 1 |
| Pondicherry, IN | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| University of Agriculture, Faisalabadlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| STNFlocation not on record | 1 |
| Dhaka, BD | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Knoxville, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Bend, US | 1 |
| Awka, NG | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Guangzhou, CN | 1 |
| Santa Cruz, US | 1 |
| Conway, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Lausanne, CH | 1 |
| Kingston, US | 1 |
| Banyoles, ES | 1 |
| Honolulu, US | 1 |
| Muzaffarabad, PK | 1 |
| PRClocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Adelaide, AU | 1 |
| Montréal, CA | 1 |
| UMKClocation not on record | 1 |
| Kensington, AU | 1 |
| Riyadh Municipalitylocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Memorial University of Newfoundlandlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| San Jose, US | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Forssa, FI | 1 |
| Monastir, TN | 1 |
| Taipei, TW | 1 |
| Sant Julià de Lòria, AD | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Namur, BE | 1 |
| Cslocation not on record | 1 |
| Nijmegen, NL | 1 |
373 institutions · 25 408 of 26 480 vouchered records shown · 834 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA160 detections
Where the DNA of Cirsium arvense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found160
Studies independent surveys2
Countries16
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 160 detections have coordinates
Open the map16 countries0
In field near ball field in Bromus inermis, …Growing in meadow surrounding cabin with Ast…Perhaps 50 stems in lawn beside greenhouse.in tall vegetation next to path
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.1 °C 12.2–19.5
Seasonal swing summer↔winter19.0 °C
Max temp (day)22.0 °C 15.2–24.0
Min temp (night)9.90 °C 7.70–15.1
Precipitation59.3 mm/mo 12.0–90.5
Air humidity57.5 % 52.6–63.3
Moisture balance-70.0 mm/mo -83.5–9.10
Vapour deficit761 Pa 548–991
Wind speed3.10 m/s 2.70–4.30
Cloud cover38.3 % 36.6–54.7
CHELSA 1981–2010, ~9 km grid, at location & month of 114 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.