Cirroteuthis muelleri

Eschricht, 1838 · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Octopoda/Cirroteuthidae/Cirroteuthis

At a glance

Occurrence records613

Data sources9

Biological traits5

DNA specimens36

eDNA detections3

Sources9 archives

Databases and archives Cirroteuthis muelleri's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility303 records↗

OBISOcean Biodiversity Information System310 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS613 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD36 specimens

01Narrative

Cirroteuthis muelleri was the first cirrate octopus species (and genus) to be scientifically described (in 1836). It is closely related to the genus Cirrothauma within the family Cirroteuthidae. At present the genus contains a single recognized species restricted to the Arctic Ocean and northern basins of the Atlantic and Pacific, but other species may be present in the southern hemisphere.Vecchione, M. & R.E. Young 2003. Cirroteuthis Eschricht, 1836. The Tree of Life Web Project.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length150 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Other traits2

Depth max4 854 m

Depth min0 m

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cirroteuthis muelleri has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes2

eDNA detections3

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

49Cmostly conserved

82Amostly conserved

85Cmostly conserved

106Tmostly conserved

142Cmostly conserved

169Cmostly conserved

292Tmostly conserved

298Amostly conserved

316Gmostly conserved

361Gmostly conserved

535Gmostly conserved

538Amostly conserved

544Tmostly conserved

571Cmostly conserved

619Amostly conserved

625Cmostly conserved

631Gmostly conserved

AACATTATATTTTATTTTTGGGATTTGATCCGGATTACTGGGAACATCCCTAAGCTTAATAATTCGAACAGAATTAGGACAACCCGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes3

BIN1

Most divergent pair2.6%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adelieledone polymorphasame order16.7%Bathypolypus pugnigersame order16.7%Octopus joubinisame order17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_069987 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6ND5ND4ND4LCYTBND6ND1COX3ND316S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type613 records

Wild obs. + sensor559

Museum / vouchered50

Other4

Range

Area of Occupancy AOO1 240 km²

Depth

0–200 m sunlit12

200–1000 m twilight82

1–4 km midnight199

>4 km abyssal2

median 1 183.3 m · max 4 986.5 m · 295 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 2

6 georeferenced · 553 without coordinates

Open the mapobservation + sensor559

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 50 records without

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	9
Washington, US	8
Santa Barbara Museum of Natural Historylocation not on record	5
The Atlantic reference Centrelocation not on record	5
CASlocation not on record	3
Paris, FR	1
Stockholm, SE	1
Maurice Lamontagne Institutelocation not on record	1

8 institutions · 33 of 50 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Cirroteuthis muelleri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)