Circaea lutetiana
speciesAt a glance
Occurrence records341 302
Data sources13
Biological traits49
DNA specimens42
eDNA detections22
Sources13 archives
Databases and archives Circaea lutetiana's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility341 302 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics42 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources49 traits
Chemical compositionLOTUS2 compounds
Occurrence & distributionGBIF341 302 records
Environmental DNA1 datasets · 4 countries22 detections
DNA & barcodingBOLD · NCBI42 specimens
Genome at a glanceCCDB · GoaT597 Mbp
01Narrative
Circaea lutetiana, la Circée de Paris, Circée commune ou Herbe aux sorcières, est une espèce de plantes à fleurs de la famille des Onagracées. C'est une plante herbacée
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology13
Leaf mass69.45 mg
Leaf size2 567 mm²
Plant height0.308 m
⚠ sources differ — GIFT: 0.308 m · LEDA: 0.325 m · TRY: 0.261 m
Plant height generative0.45 m
Plant height max0.7 m
Plant height min0.2 m
Seed length4.11 mm
Seed mass2.16 mg
⚠ sources differ — TRY: 2.16 mg · LEDA: 1.97 mg · GIFT: 2.06 mg
Seed mass max3.15 mg
Seed mass min1.38 mg
Seed volume2.6 mm³
Seed volume max2.6 mm³
Seed volume min2.6 mm³
Life cycle & reproduction14
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endAug
Flowering startJun
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals > 50 years (long-lived perennials) · GIFT: perennial
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualabsent
Seed number27.5
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTforest
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio16.39 g/g
Leaf c442 mg/g
Leaf dry-matter content (LDMC)154 mg/g
⚠ sources differ — TRY: 154 mg/g · LEDA: 194 mg/g
Leaf n27.01 mg/g
Leaf p2.77 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)46.94 mm²/mg
⚠ sources differ — TRY: 46.94 mm²/mg · LEDA: 36.7 mm²/mg · GIFT: 36.7 mm²/mg
Wood density177 mg/cm³
Other traits1
Diaspore typefruit
03Chemical composition2 compounds
Compounds documented for Circaea lutetiana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Flavones1
Flavonols1
Documented compounds2 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Astragalin | present | LOTUS | |
| Isovitexin | present | LOTUS |
05DNA & barcoding42 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Circaea lutetiana has left across the world's sequence archives.
At a glance
DNA specimens42
Marker genes7
GenBank sequences10
eDNA detections22
Countries7
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCACCCGGCCGAGGGCACGTCTGCCTGGGCGTCAATCATC …
Circaea lutetiana voucher EDNA20-0060148 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL6★rbcLa★ITS1★ITS2atpF-atpHrpoC1
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Circaea lutetiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size596 580 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Circaea lutetiana0.60 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidy2× diploid · measured
Chromosome records22–222n range22median22mode37records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2237×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +13
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · slov-fl — Kochjarová J., 1992: Karyological study of the Slovak flora XXVIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 67-74.
CCDB · brit-fl — Raven, P.H. Watsonia 5: 262-272 (1963)
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XII. Onagraceae Queirs, M.Bol. Soc. Brot. ser. 250: 107-116(1976).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3072
CCDB · fl-europaea — LOvkvist, 1963
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. In: IOPB chromosome number reports LXXIV. Taxon 31: 120–126.
CCDB · ipcn-api-dl — Stepanov, N. V. 1992. Chromosome numbers in representatives of some families of higher plants. Bot. Žhurn. (Moscow & Leningrad) 77(2): 113–114.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · ipcn-api-dl — Stepanov, N. V. 1994. Chromosome numbers in some nemoral species of the West Sayan (Krasnoyarsk region). Bot. Žhurn. (Moscow & Leningrad) 79(3): 125–128.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · ipcn-api-dl — Seavey, S. R. & D. E. Boufford. 1983. Observations of chromosomes in Circaea (Onagraceae). Amer. J. Bot. 70 : 1476–1481.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.
CCDB · book-ipcn67-71 — JUNGBLUT, F. 1967. Le genre Circaea L. dans le Grande-Duche de Luxembourg. Arch. Inst. Gr.-Duc. Luxemb. N.S. 32: 75-116.
CCDB · book-ipcn67-71 — SKALINSKA, M., E. POGAN, & A. JANKUN. 1968. Further studies in chromosome numbers of Polish Angiosperms, VII. Acta Biol. Cracov. Ser. Bot. 11: 199-224.
CCDB · book-ipcn67-71 — SKALINSKA, M., A. JANKUN, H. WCISLO ET AL. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov., Ser. Bot. 14: 55-102.
CCDB · book-indian_vol1 — Uddling, A. 1929; Delay, C. 1947; Love, A. 1954b; Jungblut, F. 1967; Sklilinska, M. et at. 1968, 1971 ; Schotsman, H.D. 1970; Van Loon, J. Chr. & Kieft, B. 1980
CCDB · eflora
CCDB · book-atlas-flowering-plants — Uddling 1929
CCDB · kew — Pustahija F, Brown SC, Bogunic F, Bašic N, Muratovic E, Ollier S, Hidalgo O, Bourge M, Stevanovic V, Sijak-Yakovev S. 2013. Small genomes dominate in plants growing on serpentine soils in West Balkans, an exhaustive study of 8 habitats covering 308 taxa.
CCDB · CromoCat 2015 — Al-Bermani, A.-K. K. A., Al-Shammary, K. I. A., Gornall, R. J. & Bailey, J. P. (1993). Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169-171.
CCDB · CromoCat 2015 — Cheshmedziev, I. V. (1994). Reports (313-366). Fl. Medit. 4: 269-279.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Loon van, J. C. & Kieft, B. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 538-542. si
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Queirós, M. (1976). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XII. Onagraceae. Bol. Soc. Brot. 50: 107-116.
CCDB · CromoCat 2015 — Stepanov, N. V. (1992). Chromosome numbers in representatives of some families of higher plants Botani?eskij Žurnal (Moscow & Leningrad) 77(2): 113-114
CCDB · CromoCat 2015 — Stepanov, N. V. (1994a). Chromosome numbers of some higher plants taxa of the flora of Krasnoyarsk region. Bot. Žurn. 79(2): 135-139.
CCDB · CromoCat 2015 — Seavey, S. R. & D. E. Boufford (1983). Observations of chromosomes in Circaea (Onagraceae) Amer. J. Bot. 70 : 1476–1481
CCDB · iapt — IAPT/IOPB Chromosome Data 34
n 117×CCDB · ipcn-api-dl · CCDB · Cave1962 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Boufford, D. E. 1982. The genus Circaea (Onagraceae) in Japan. Acta Phytotax. Geobot. 33: 28–40.
CCDB · ipcn-api-dl — Seavey, S. R. & D. E. Boufford. 1983. Observations of chromosomes in Circaea (Onagraceae). Amer. J. Bot. 70 : 1476–1481.
CCDB · Cave1962 — Kurabayashi et al. 1962
CCDB · CromoCat 2015 — Seavey, S. R. & D. E. Boufford (1983). Observations of chromosomes in Circaea (Onagraceae) Amer. J. Bot. 70 : 1476–1481
CCDB · CromoCat 2015 — Boufford, D. E. (1982). The genus Circaea (Onagraceae) in Japan Acta Phytotax. Geobot. 33: 28–40
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type341 302 records
Wild obs. + sensor330 823
Museum / vouchered8 364
Cultivated / captive403
Other1 712
Origin
Native25 151
Introduced21
Range
Area of Occupancy AOO322 264 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy42% within 1 km
≤100 m 60 462≤1 km 58 273≤10 km 165 058>10 km 1 669
285 462 georeferenced · 45 361 without coordinates
Open the mapobservation + sensor330 823
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 373≤1 km 1 627≤10 km 3 559>10 km 82
5 641 georeferenced · 2 723 without coordinates
Open the institutions mapphysical evidence8 364
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 11
11 georeferenced · 392 without coordinates
Open the mapnot free-living403
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions106 of 209 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 4 053 |
| LDlocation not on record | 345 |
| Moscow State Universitylocation not on record | 292 |
| MeiseBGlocation not on record | 198 |
| BFLlocation not on record | 178 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 128 |
| Adam Mickiewicz University in Poznańlocation not on record | 121 |
| Karlsruhe, DE | 119 |
| Görlitz, DE | 114 |
| Oskarshamn, SE | 109 |
| Olocation not on record | 101 |
| Salzburg, AT | 94 |
| Bergen, NO | 87 |
| BRNUlocation not on record | 84 |
| GJOlocation not on record | 73 |
| Provincia di Livornolocation not on record | 72 |
| Bronx, US | 69 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 67 |
| SLU Artdatabankenlocation not on record | 50 |
| Chongqing Museumlocation not on record | 47 |
| Mlocation not on record | 46 |
| DBF-NHMDlocation not on record | 44 |
| MAlocation not on record | 38 |
| Bangkok, TH | 36 |
| South Kensington, GB | 35 |
| Berlin, DE | 34 |
| BDBClocation not on record | 30 |
| Barcelona, ES | 30 |
| Bern, CH | 28 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 27 |
| New Haven, US | 27 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 24 |
| Wlocation not on record | 24 |
| València, ES | 23 |
| Vitoria, ES | 22 |
| Uppsala, SE | 22 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 20 |
| Natural History Museum Rotterdamlocation not on record | 20 |
| College Park, US | 19 |
| Saint John, CA | 18 |
| Entomological Society of Latvialocation not on record | 15 |
| PRClocation not on record | 15 |
| Frankfurt am Main | 15 |
| KMNlocation not on record | 14 |
| Salamanca, ES | 14 |
| BSBIlocation not on record | 14 |
| BClocation not on record | 14 |
| Fulda, DE | 13 |
| Tartu, EE | 13 |
| Zürich, CH | 12 |
| Porrentruy, CH | 12 |
| Madrid, ES | 11 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 11 |
| CICYTEXlocation not on record | 10 |
| CJBGlocation not on record | 10 |
| Uniwersytet Śląski w Katowicachlocation not on record | 10 |
| PrivatHerblocation not on record | 9 |
| 东北师范大学自然博物馆location not on record | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 9 |
| Spearfish, US | 9 |
| Madison, US | 8 |
| McWane Science Centerlocation not on record | 8 |
| Urumqi, CN | 8 |
| Bourges, FR | 8 |
| GZUlocation not on record | 8 |
| Acadia Universitylocation not on record | 8 |
| Whitewater, US | 8 |
| Trondheim, NO | 8 |
| Zürich, CH | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Davenport, US | 7 |
| Uniwersytet Jagiellońskilocation not on record | 7 |
| Zhengzhou, CN | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| Tilburg, NL | 6 |
| Toronto, CA | 6 |
| Frauenfeld, CH | 6 |
| National Museum Waleslocation not on record | 6 |
| Uniwersytet Warszawskilocation not on record | 6 |
| University of Stellenboschlocation not on record | 5 |
| US | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| Tempe, US | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Columbia, US | 4 |
| Philadelphia, US | 4 |
| Miami, US | 4 |
| Sion, CH | 4 |
| Badajoz, ES | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Wellington, NZ | 4 |
| Kew, GB | 4 |
| Dover, US | 4 |
| Québec, CA | 4 |
| Glarus, CH | 4 |
| Flagstaff, US | 4 |
| Nijmegen, NL | 4 |
| Smithsonian Institutionlocation not on record | 4 |
| FLADlocation not on record | 3 |
| San Angelo, US | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Helsinki, FI | 3 |
| Granada, ES | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| UGentlocation not on record | 3 |
| Fargo, US | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Salvador, BR | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Saint Louis, US | 3 |
| Denver, US | 3 |
| Alicante, ES | 3 |
| ISAlocation not on record | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Winterthur, CH | 3 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 3 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Edinburgh, GB | 2 |
| Williamsburg, US | 2 |
| Pamplona, ES | 2 |
| Montréal, CA | 2 |
| TROMlocation not on record | 2 |
| Tallinn, EE | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Boumlocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| Gijón, ES | 2 |
| Beijing, CN | 2 |
| Taipei, TW | 2 |
| BAYLUlocation not on record | 2 |
| Ivano-Frankove, UA | 2 |
| Monastir, TN | 2 |
| Tula State Universitylocation not on record | 2 |
| Guangzhou, CN | 2 |
| Macomb, US | 2 |
| Yangling, CN | 2 |
| Staten Island, US | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| St. Paul, US | 2 |
| BEIlocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Jurica-Suchy Nature Museumlocation not on record | 2 |
| NMBU:MINAlocation not on record | 2 |
| Decorah, US | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Philadelphia, US | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| ZRC-SAZUlocation not on record | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| University of New Hampshirelocation not on record | 2 |
| Dekalb, US | 2 |
| Moscow, US | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| OLAlocation not on record | 1 |
| ASUlocation not on record | 1 |
| Waverly, US | 1 |
| Porvoo, FI | 1 |
| Montréal, CA | 1 |
| Minia, EG | 1 |
| H-Schuhwlocation not on record | 1 |
| Pullman, US | 1 |
| Clemson, US | 1 |
| Université Lavallocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Durham, US | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Banyoles, ES | 1 |
| Keene State Universitylocation not on record | 1 |
| Provo, US | 1 |
| Nanchong, CN | 1 |
| FLASlocation not on record | 1 |
| Paris, FR | 1 |
| Mexico City, MX | 1 |
| AUAlocation not on record | 1 |
| Stockholm, SE | 1 |
| Chapel Hill, US | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Turku, FI | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| Irkutsk State Universitylocation not on record | 1 |
| Dresden, DE | 1 |
| nbflocation not on record | 1 |
| Xiamen, CN | 1 |
| BioFokuslocation not on record | 1 |
| Turlock, US | 1 |
| Kingston, US | 1 |
| Podgorica, ME | 1 |
| Shenyang Agricultural Universitylocation not on record | 1 |
| Tuscaloosa, US | 1 |
| H-AkrKGlocation not on record | 1 |
| Richmond, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Chicago, US | 1 |
| Mississippi State, US | 1 |
| Universität Göttingenlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| EL PASO, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| Namur, BE | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Bloomington, US | 1 |
209 institutions · 7 606 of 8 364 vouchered records shown · 604 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA22 detections
Where the DNA of Circaea lutetiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map4 countries0
weed
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.4 °C 12.1–21.0
Seasonal swing summer↔winter14.5 °C
Max temp (day)21.1 °C 15.1–26.2
Min temp (night)13.5 °C 8.50–15.4
Precipitation93.7 mm/mo 75.0–134
Air humidity60.7 % 56.1–65.9
Moisture balance-37.1 mm/mo -44.3–37.5
Vapour deficit786 Pa 517–1,090
Wind speed3.90 m/s 2.70–4.90
Cloud cover40.9 % 36.6–48.7
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.