Cipocereus minensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Cipocereus

At a glance

Occurrence records98

Data sources7

Biological traits10

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Cipocereus minensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility98 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF98 records

DNA & barcodingNCBIsequences

01Narrative

Cipocereus minensis ist eine Pflanzenart aus der Gattung Cipocereus in der Familie der Kakteengewächse (Cactaceae). Das Artepitheton minensis bezieht sich auf das Vorkommen im brasilianischen Bundesstaat Minas Gerais.Urs Eggli, Leonard E. Newton: Etymological Dictionary of Succulent Plant Names. Birkhäuser 2004, ISBN 3-540-00489-0, S. 154.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyte detailedterrestrial

Growth form detailedshrub

Habitat GIFTCampo Rupestre, Vegetação Sobre Afloramentos Rochosos

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cipocereus minensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKJX683867.1 ↗2 458 bp

ACGT

GTGCGGCTAGGATCTTTTACATATTTGGATGAAGCAAGGAATTCGTCTACATCATCGGTAGAGTTTATCAGACCACGACTGATCCTGAAA …

Cipocereus minensis isolate E225 tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1

plant barcode

08Occurrence & distribution

Record type98 records

Wild obs. + sensor39

Museum / vouchered59

Origin

Native29

Range

Area of Occupancy AOO352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 39

39 georeferenced

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
JBRJlocation not on record	13
Kew, GB	9
UFMGlocation not on record	7
FPMZBlocation not on record	6
UFSCarlocation not on record	4
UFVJMlocation not on record	4
Bronx, US	3
UNICAMPlocation not on record	2
Ural Federal University "B. N. Yeltsin"location not on record	2
UNESP-RClocation not on record	2
Uberlândia, BR	1
Cruz das Almas, BR	1
Departamento de Geologia, Universidad de Chilelocation not on record	1
UnBlocation not on record	1
USP-IBlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
UTFPR-CPlocation not on record	1

17 institutions · 59 of 59 vouchered records shown