Cinnamosma fragrans

Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Canellales/Canellaceae/Cinnamosma

At a glance

Occurrence records251

Data sources10

Biological traits14

DNA specimens3

eDNA detections4

Sources10 archives

Databases and archives Cinnamosma fragrans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility251 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS29 compounds

Occurrence & distributionGBIF251 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Cinnamosma fragrans is a species of flowering plant in the family Canellaceae. It is endemic to Madagascar.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Seed volume730 mm³

Seed volume max730 mm³

Seed volume min730 mm³

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition29 compounds

Compounds documented for Cinnamosma fragrans across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Drimane sesquiterpenoids20

Spirostane steroids4

Prenyl quinone meroterpenoids2

Monosaccharides1

Furostane steroids1

Documented compounds29 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Cinnamodial	present	LOTUS
(1S,2S,4S,5'R,6R,7S,8R,9S,12R,13S,15R,16R,18R)-16-[(2R,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-12,15,18-triol	present	NPASS
(1S,2S,4S,6R,7S,8R,9S,12R,13S,15R,16R,18R)-16-[(2R,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-6-methoxy-7,9,13-trimethyl-6-[(3R)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-12,15,18-triol	present	NPASS
(2S)-2,8-dimethyl-2-[(3E,7E)-4,8,12-trimethyltrideca-3,7,11-trienyl]chroman-6-ol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-2-[(1S,2S,4S,5'R,6R,7S,8R,9S,12S,13R,15R,16R,18R)-15,18-dihydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-16-yl]oxy-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-2-[(2R,4S,5'R,6R,7S,8R,9S,12S,13R,15R,16R,18R)-15,18-dihydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-1(20)-ene-6,2'-oxane]-16-yl]oxy-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-2-[(2R,4S,5'R,6R,7S,8R,9S,13R,15R,16R,18R)-15,18-dihydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosa-1(20),11-diene-6,2'-oxane]-16-yl]oxy-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(5aR,9aS)-6,6,9a-trimethyl-1,4,5a,7,8,9-hexahydrobenzo[e][2]benzofuran-3,5-dione	present	LOTUS
(5aR,9aS,9bR)-6,6,9a-trimethyl-5,5a,7,8,9,9b-hexahydro-1H-benzo[e][2]benzofuran-3-one	present	LOTUS
(5aS)-6,6,9abeta-Trimethyl-5,5aalpha,6,7,8,9,9a,9balpha-octahydronaphtho[1,2-c]furan-3(1H)-one	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cinnamosma fragrans has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences4

eDNA detections4

The DNA barcodea real sequence read deposited for this species

matKKP407479.1 ↗2 722 bp

ACGT

ACACATTTGGATGAAGCAAGGAATTCGTCCATACCATTGGTATAGTTTGTAAGACTGCGACTGATCCTGAAAGGGAACGAATGGAAAAAA …

Cinnamosma fragrans isolate DP129 maturase K (matK) gene, complete cds; and tRNA-Lys (trnK) gene and trnK-psbA intergenic spacer, partial sequence; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4

plant barcode

07Deep time~0.64 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0.64 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type251 records

Wild obs. + sensor38

Museum / vouchered213

Range

Area of Occupancy AOO368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 27

27 georeferenced · 11 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 10≤10 km 3

13 georeferenced · 200 without coordinates

Open the institutions mapphysical evidence213

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	49
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	36
Plocation not on record	35
Kew, GB	19
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	15
CJBGlocation not on record	11
Glocation not on record	11
Paris, FR	6
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	6
Stockholm, SE	3
MAlocation not on record	3
CASlocation not on record	2
South Kensington, GB	2
Pretoria, ZA	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Llocation not on record	1
Zlocation not on record	1
Bronx, US	1
MeiseBGlocation not on record	1

19 institutions · 204 of 213 vouchered records shown · 9 without an institution code

09Environmental DNA4 detections

Where the DNA of Cinnamosma fragrans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)