Cinnamomum septentrionale

Hand.-Mazz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Cinnamomum

At a glance

Occurrence records116

Data sources7

Biological traits22

DNA specimens4

eDNA detections3

Sources7 archives

Databases and archives Cinnamomum septentrionale's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility116 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources22 traits

Occurrence & distributionGBIF116 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Cinnamomum septentrionale Hand.-Mazz. – gatunek rośliny z rodziny wawrzynowatych. Występuje naturalnie w środkowych Chinach – w zachodniej części Syczuanu, południowej części Shaanxi oraz w południowym Gansu.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology14

Fruit length10 mm

Fruit length max10 mm

Fruit length min10 mm

Fruit width10 mm

Fruit width max10 mm

Fruit width min10 mm

Leaf length125 mm

Leaf length max150 mm

Leaf length min100 mm

Leaf width max70 mm

Leaf width min50 mm

Plant height20.5 m

⚠ sources differ — GIFT: 20.5 m · TRY: 25 m

Plant height max25 m

Plant height min16 m

Life cycle & reproduction1

Life spanperennial

Habitat & environment6

Climberself-supporting

Elevation max1 000 m

Elevation mean800 m

Elevation min600 m

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cinnamomum septentrionale has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH703394.1 ↗380 bpChina · 2015

ACGT

TTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTCGGCCGAGGGCACGCCTGCCTGGG …

Cinnamomum septentrionale voucher wh020 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL6★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type116 records

Museum / vouchered113

Cultivated / captive3

Range

Area of Occupancy AOO172 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 112 without coordinates

Open the institutions mapphysical evidence113

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced

Open the mapnot free-living3

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yangling, CN	35
Beijing, CN	25
Seoul, KR	13
Kunming, CN	8
WNNUlocation not on record	6
云南省思茅市民族传统医药研究所location not on record	4
Xian, CN	4
Wuhan, CN	3
Guangzhou, CN	2
Strecker Museum, Baylor Universitylocation not on record	2
Herbarium of South China Botanical Gardenlocation not on record	2
Jiangxi Universitylocation not on record	1
Zhuzhou, CN	1
Nanjing, CN	1
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	1
Wuhan, CN	1
Chongqing, CN	1

17 institutions · 110 of 113 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Cinnamomum septentrionale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.0 °C 25.2–28.8

Seasonal swing summer↔winter24.7 °C

Max temp (day)30.0 °C 28.4–31.6

Min temp (night)23.5 °C 21.3–25.6

Precipitation274 mm/mo 266–282

Air humidity64.1 % 63.2–64.9

Moisture balance127 mm/mo 98.7–154

Vapour deficit1,298 Pa 1,132–1,464

Wind speed2.40 m/s 2.00–2.80

Cloud cover40.7 % 40.3–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)