Cinnamomum osmophloeum

Kaneh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Cinnamomum

At a glance

Occurrence records529

Data sources11

Biological traits21

DNA specimens16

eDNA detections16

Sources11 archives

Databases and archives Cinnamomum osmophloeum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility529 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS · NPASS24 compounds

Occurrence & distributionGBIF529 records

Environmental DNA1 datasets · 0 countries16 detections

DNA & barcodingBOLD · NCBI16 specimens

01Narrative

Cinnamomum osmophloeum, commonly known as pseudocinnamomum or indigenous cinnamon, is a medium-sized evergreen tree in the genus Cinnamomum. It is native to broad-leaved forests of central and northern Taiwan. Cinnamaldehyde, an essential oil extracted from C. osmophloeum, has numerous commercial uses. Also, it is a xanthine oxidase inhibitor, hence a potential drug for treatment of hyperuricemia and related medical conditions including gout.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Fruit length10 mm

Fruit length max10 mm

Fruit length min10 mm

Fruit width5 mm

Fruit width max5 mm

Fruit width min5 mm

Leaf length100 mm

Leaf length max120 mm

Leaf length min80 mm

Leaf width max50 mm

Leaf width min35 mm

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment7

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation mean950 m

Elevation min400 m

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition24 compounds

Compounds documented for Cinnamomum osmophloeum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols4

Acyclic monoterpenoids4

Cinnamic acids and derivatives4

Furofuranoid lignans3

Dibenzylbutane lignans3

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,4R)-1,7,7-trimethylbicyclo(2.2.1)heptan-2-ol	present	LOTUS
(6S,7R,8S)-8-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-bis(hydroxymethyl)-1,3-dimethoxy-5,6,7,8-tetrahydronaphthalen-2-ol	present	LOTUS
1,4-Bis(3,4,5-trimethoxyphenyl)tetrahydro-1H,3H-furo(3,4-c)furan	present	LOTUS
1,4-O-Diferuloylsecoisolariciresinol	present	LOTUS
3-[(2S,3R,4S,5R,6S)-3,4-dihydroxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-2-(4-hydroxyphenyl)-7-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-4-one	present	LOTUS
3-[(2S,3R,4S,5R,6S)-5-[(2S,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-3,4-dihydroxy-6-methyloxan-2-yl]oxy-5-hydroxy-2-(4-hydroxyphenyl)-7-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-4-one	present	LOTUS
3-[(2S,3R,4S,5S)-3-[(2S,3R,4R)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-4-hydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-5-hydroxy-2-(4-hydroxyphenyl)-7-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-4-one	present	LOTUS
3-Phenyl-2-propen-1-yl acetate	present	LOTUS
3-Phenylprop-2-Enal	present	LOTUS
alpha-Terpineol	present	LOTUS

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cinnamomum osmophloeum has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes3

GenBank sequences10

eDNA detections16

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKY271524.1 ↗611 bp

ACGT

TTGGAATCCATGAAGGCGCGCGGCCGGGGGACTATGCCCGGGGACGCGCGTCCCGTCGAGCTCCGAACAACAACCCTCTGGGCGCGGCGA …

Cinnamomum osmophloeum isolate C38 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS9★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type529 records

Wild obs. + sensor236

Museum / vouchered287

Other6

Origin

Native26

Range

Area of Occupancy AOO1 084 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy3% within 1 km

≤100 m 1≤1 km 2>10 km 96

99 georeferenced · 137 without coordinates

Open the mapobservation + sensor236

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 283 without coordinates

Open the institutions mapphysical evidence287

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	164
Taipei, TW	38
National Museum of Natural Sciencelocation not on record	38
TAIElocation not on record	28
Taipei, TW	10
Jiangxi Universitylocation not on record	2
Beijing, CN	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Nagasaki University - Fisherieslocation not on record	1
MeiseBGlocation not on record	1
Honolulu, US	1
Edinburgh, GB	1

12 institutions · 286 of 287 vouchered records shown · 1 without an institution code

09Environmental DNA16 detections

Where the DNA of Cinnamomum osmophloeum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)