Cinnamomum oliveri

F.M.Bailey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Cinnamomum

At a glance

Occurrence records1 245

Data sources10

Biological traits38

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Cinnamomum oliveri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 245 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Chemical compositionLOTUS · NPASS54 compounds

Occurrence & distributionGBIF1 245 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Cinnamomum oliveri is a rainforest tree growing at the eastern coastal parts of Australia. It grows from the Illawarra district (34° S) in New South Wales to Cape York Peninsula at the northern tip of Australia. The southernmost limit of natural distribution is on the volcanic cliffs above the town of Gerroa and nearby on the sand in rainforest behind Seven Mile Beach, New South Wales. Named after Daniel Oliver of Kew Gardens. Cinnamomum oliveri, has several common names, such as the camphorwood, Oliver's sassafras, black sassafras and cinnamonwood. It is a medium to large tree to around 30 metres tall and 75 cm in diameter.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology14

Fruit length15 mm

Fruit width14 mm

Leaf length85 mm

Leaf length max150 mm

Leaf length min80 mm

Leaf mass per area103 g/m2

Leaf size1 969 mm²

Leaf width30 mm

Leaf width max30 mm

Leaf width min20 mm

Petiole length0.9 cm

Plant height20 m

⚠ sources differ — GIFT: 20 m · AusTraits: 25 m

Seed length13 mm

Seed width10.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnnnnnnynn

Life formtree

Life spanperennial

Lifespan years60 years

⚠ sources differ — TRY: 60 years · AusTraits: 25 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.93 mm²/mg

Wood density478 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition54 compounds

Compounds documented for Cinnamomum oliveri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Quinoline alkaloids6

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids4

Acridone alkaloids4

Menthane monoterpenoids $ Monocyclic monoterpenoids3

Steroidal alkaloids3

Documented compounds54 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-alpha-Pinene	present	LOTUS
(+)-Corlumine	present	LOTUS
(+)-Lupanine	present	LOTUS
(+)-Secoisolariciresinol	present	NPASS
(-)-Hydrastine	present	LOTUS
(-)-Menthol	present	LOTUS
(2E,4E,6E)-5-(acetyloxymethyl)tetradeca-2,4,6-trienoic acid	present	LOTUS
(4R)-1-hydroxy-2,4-dimethoxy-10-methyl-4-(3-methylbut-2-enyl)acridine-3,9-dione	present	NPASS
(4S)-4-[(2E)-3,7-dimethylocta-2,6-dienyl]-1-hydroxy-2,4-dimethoxy-10-methylacridine-3,9-dione	present	NPASS
2-Isopropyl-5-methylphenol	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cinnamomum oliveri has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKU139865.1 ↗569 bpAustralia

ACGT

CCCGGGGGCGACCCGGGGACGCGCGTCCGGACGAGCTCCGAACAACAACCCTATGGGCGCGGCGAGCGCCAAGGAATCGAAGCGGAAAGG …

Cinnamomum oliveri voucher Tng D. 274 (CNS) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type1 245 records

Wild obs. + sensor860

Museum / vouchered283

Cultivated / captive3

Other99

Origin

Native43

Range

Area of Occupancy AOO2 804 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 735≤1 km 56≤10 km 18>10 km 3

812 georeferenced · 48 without coordinates

Open the mapobservation + sensor860

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 55≤1 km 39≤10 km 72>10 km 33

199 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence283

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	99
Brisbane, AU	73
Mount Annan, AU	42
Canberra, AU	14
John T. Waterhouse Herbariumlocation not on record	10
Museo Entomologico de Leonlocation not on record	9
Armidale, AU	7
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Wollongong, AU	4
Paris, FR	4
Kew, GB	2
Palmerston, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
La Trobe Universitylocation not on record	1
University of Stellenboschlocation not on record	1
Christchurch, NZ	1

16 institutions · 274 of 283 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Cinnamomum oliveri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 18.3–18.3

Seasonal swing summer↔winter10.6 °C

Max temp (day)23.0 °C

Min temp (night)14.4 °C

Precipitation132 mm/mo

Air humidity61.0 %

Moisture balance13.6 mm/mo

Vapour deficit823 Pa

Wind speed3.10 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cinnamomum oliveri

At a glance

Sources10 archives

Size & morphology14

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Other traits1

Compound class profile5 classes

Documented compounds54 total

At a glance

Record type1 245 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 245 records