Cinnamomum laubatii

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Cinnamomum

At a glance

Occurrence records353

Data sources9

Biological traits34

DNA specimens9

eDNA detections5

Sources9 archives

Databases and archives Cinnamomum laubatii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility353 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF353 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Cinnamomum laubatii là loài thực vật có hoa trong họ Nguyệt quế. Loài này được F.Muell. miêu tả khoa học đầu tiên năm 1866.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology14

Fruit length19 mm

⚠ sources differ — AusTraits: 19 mm · GIFT: 23.3 mm

Fruit width13.5 mm

Leaf length112 mm

Leaf mass163 mg

Leaf mass per area101 g/m2

Leaf size1 951 mm²

Leaf width30 mm

Petiole length1 cm

Plant height28 m

⚠ sources differ — GIFT: 28 m · AusTraits: 35 m

Seed length15 mm

Seed mass650 mg

Seed mass max650 mg

Seed mass min650 mg

Seed width10.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timenyyyyynnnnnn

Life formtree

Life spanperennial

Pollination syndromebeetle

Sex typehermaphrodite

Habitat & environment8

Climateseasonally dry tropical

Climberself-supporting

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density410 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Cinnamomum laubatii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Monocyclic monoterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
p-Mentha-1(7),2-dien-8-ol		present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cinnamomum laubatii has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences2

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKU139855.1 ↗605 bpAustralia

ACGT

GAACCAGTCCCGCGAGAAGGCCGCCCGCGGCGCGCGGCCCCGGGGCGACCCGGGGACGCGCGTCCGGACGAGCTCCGAACAACAACCCTA …

Cinnamomum laubatii voucher Costion C. 1550 (CNS) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type353 records

Wild obs. + sensor3

Museum / vouchered323

Cultivated / captive1

Other26

Origin

Native15

Range

Area of Occupancy AOO532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 28≤1 km 47≤10 km 101>10 km 21

197 georeferenced · 126 without coordinates

Open the institutions mapphysical evidence323

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	136
Brisbane, AU	69
Canberra, AU	31
Museo Entomologico de Leonlocation not on record	19
Mount Annan, AU	16
Kew, GB	8
Saint Louis, US	6
Palmerston, AU	4
Australian Tropical Herbariumlocation not on record	2
Claremont, US	1
James Cook Townsvillelocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
Parkville, AU	1
Armidale, AU	1
University of the Sunshine Coastlocation not on record	1

15 institutions · 297 of 323 vouchered records shown · 25 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Cinnamomum laubatii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.3 °C 17.2–24.3

Seasonal swing summer↔winter7.70 °C

Max temp (day)26.9 °C 21.5–28.4

Min temp (night)17.4 °C 12.3–20.9

Precipitation81.8 mm/mo 22.0–214

Air humidity62.9 % 48.4–69.4

Moisture balance-58.3 mm/mo -121–42.0

Vapour deficit940 Pa 724–1,460

Wind speed2.60 m/s 1.20–3.80

Cloud cover31.8 % 21.4–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)