Cinnamomum glaucescens

(Buch.-Ham. ex Nees) Hand.-Mazz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Cinnamomum

At a glance

Occurrence records40

Data sources8

Biological traits19

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Cinnamomum glaucescens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources19 traits

Occurrence & distributionGBIF40 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 24

01Narrative

Cinnamomum glaucescens (Nepali:सुगन्धकोकिला, Sugandhakokila) is an evergreen tree native to Bhutan, India (Sikkim, Manipur and the Khasi Hills), and Nepal. The pericarp of the fruits can be distilled for an essential oil, sugandha kokila oil, which is used in perfumery and traditional medicine. This species is diploid and can grow to an altitude of 1300 m. Cinnamomum glaucescens is recognized as an aromatic plant, meaning it has an elevated level of essential oil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology7

Plant height11.5 m

Seed mass3.84 mg

Seed mass max3.84 mg

Seed mass min3.84 mg

Seed volume740 mm³

Seed volume max740 mm³

Seed volume min740 mm³

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Habitat & environment7

Climberself-supporting

Elevation max1 200 m

Elevation min200 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Wood density448 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cinnamomum glaucescens has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMF186598.1 ↗555 bpIndia

ACGT

AGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATTTTGGC …

Cinnamomum glaucescens clone xyz2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Cinnamomum glaucescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Mehra, P .N. & Bawa, K.S. 1969 ; Mehra, P.N. 1972

n 124×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn67-71 +1

CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.

CCDB · book-ipcn72 — MEHRA, P.N. 1972. Cytogenetical evolution of hardwoods. Nucleus 15: 64-83.

CCDB · book-ipcn67-71 — MEHRA, P.N., & K.S. BAWA. 1969. Chromosomal evolution in tropical hardwoods. Evolution 23: 466-481.

CCDB · book-ipcn75-78 — Mehra 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type40 records

Wild obs. + sensor1

Museum / vouchered39

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	26
Kew, GB	1
South Kensington, GB	1
Edinburgh, GB	1

4 institutions · 29 of 39 vouchered records shown · 10 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)