Cinnamomum citriodorum — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Cinnamomum

At a glance

Occurrence records10

Data sources6

Biological traits6

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Cinnamomum citriodorum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF10 records

DNA & barcodingNCBIsequences

01Narrative

Cinnamomum citriodorum is a species of flowering plant in the family Lauraceae. It is endemic to Western Ghats and Sri Lanka.World Conservation Monitoring Centre. 1998. Cinnamomum citriodorum. The IUCN Red List of Threatened Species 1998. Downloaded on 26 September 2015. It is commonly known as Malabar Cinnamon. It has a characteristic smell of lemon grass. C. citriodorum has 45% Cinnamaldehyde compared to 80% for C. cassia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment3

Climateseasonally dry tropical

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cinnamomum citriodorum has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOQ874734.1 ↗599 bp

ACGT

CGAACCAGTCCCGCGAGAAGGACGCTCGCGGCGCGCGGCCCGTGGGACGCGCGTCCGGACGAGCTCCGAACAACAAAACCCTCTGGGCGC …

Cinnamomum citriodorum voucher KGG.BS-2018-8-C-M-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK4rbcL5ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type10 records

Museum / vouchered10

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	3

1 institutions · 3 of 10 vouchered records shown · 7 without an institution code