Cinnamomum camphora
(L.) J.Presl · speciesAt a glance
Occurrence records13 046
Data sources15
Biological traits61
DNA specimens76
eDNA detections49
Sources15 archives
Databases and archives Cinnamomum camphora's data was compiled from.
WikipediaWikimedia Foundation20 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 046 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics76 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources61 traits
Chemical compositionLOTUS · NPASS203 compounds
Occurrence & distributionGBIF13 046 records
Environmental DNA1 datasets · 7 countries49 detections
DNA & barcodingBOLD · NCBI76 specimens
Genome at a glanceCCDB · GIFT · GoaT726 Mbp
01Narrative
Cinnamomum camphora is a species of evergreen tree that is commonly known under the names camphor tree, camphorwood or camphor laurel.Camphor - The Wood Database
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsTRY
Size & morphology25
Fruit length8.5 mm
⚠ sources differ — AusTraits: 8.5 mm · GIFT: 7 mm
Fruit length max8 mm
Fruit length min6 mm
Fruit width9 mm
⚠ sources differ — AusTraits: 9 mm · GIFT: 7 mm
Fruit width max8 mm
Fruit width min6 mm
Inflorescence length max7.0 cm
Inflorescence length min3.5 cm
Leaf length75 mm
⚠ sources differ — AusTraits: 75 mm · GIFT: 90 mm
Leaf length max120 mm
Leaf length min50 mm
Leaf size4 449 mm²
Leaf width37.5 mm
Leaf width max55 mm
Leaf width min25 mm
Petiole length3 cm
Plant height22.5 m
⚠ sources differ — GIFT: 22.5 m · AusTraits: 20 m · TRY: 15.3 m
Plant height max20 m
Plant height min5 m
Seed mass108 mg
Seed mass max142 mg
Seed mass min77 mg
Seed volume74.5 mm³
Seed volume max130 mm³
Seed volume min19 mm³
Life cycle & reproduction10
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flowering timennnnnnnyyynn
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formphanerophyte
Resprouting capacityresprouts
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climberself-supporting
Elevation max1 950 m
Elevation min1 950 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typedrupe
⚠ sources differ — AusTraits: drupe · GIFT: berry
Growth formtree
Leaf compoundnesssimple
Leaf formlanceolate
Leaf shapeelliptical ovate widely_ovate
Mycorrhiza typearbuscular
Woodinesswoody
Physiology & chemistry9
Leaf C:N ratio27.34 g/g
Leaf c451 mg/g
Leaf dry-matter content (LDMC)414 mg/g
Leaf n15.27 mg/g
Leaf p0.99 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)13.73 mm²/mg
Wood density487 mg/cm³
⚠ sources differ — TRY: 487 mg/cm³ · GIFT: 580 mg/cm³
Other traits3
Leaf marginentire
Leaf spinesno
Leaf thornsno
03Chemical composition203 compounds
Compounds documented for Cinnamomum camphora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Acyclic monoterpenoids15
Cadinane sesquiterpenoids14
Furofuranoid lignans10
Menthane monoterpenoids $ Monocyclic monoterpenoids10
Cinnamic acids and derivatives9
Documented compounds203 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-1(10),4-Cadinadiene | present | LOTUS | |
| (+)-alpha-Bulgarene | present | LOTUS | |
| (+)-alpha-Carene | present | LOTUS | |
| (+)-alpha-Pinene | present | LOTUS | |
| (+)-Asarinin | present | LOTUS | |
| (+)-Camphene | present | LOTUS | |
| (+)-Fenchone | present | LOTUS | |
| (+)-gamma-Bulgarene | present | LOTUS | |
| (+)-gamma-Eudesmol | present | LOTUS | |
| (+)-Isoborneol | present | LOTUS |
05DNA & barcoding76 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cinnamomum camphora has left across the world's sequence archives.
At a glance
DNA specimens76
Marker genes7
GenBank sequences10
eDNA detections49
Countries9
The DNA barcodea real sequence read deposited for this species
GATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATTTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTT …
Cinnamomum camphora isolate MC123 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL9★rbcLa★ITS★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Cinnamomum camphora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size726 165 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cinnamomum camphora0.73 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records14–242n range24median24mode13records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2411×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · eflora +4
CCDB · ipcn-api-dl — Nagl, W., W. Habermann & H. p. Fusenig. 1977. Nuclear DNA contents in four primitive s Angiosperms. Pl. Syst. Evol. 127: 103–105.
CCDB · ipcn-api-dl — Chen, C. b., X. l. Li, C. r. Sun, W. q. Song & R. y. Chen. 1998. Studies on the karyotype of 9 species of 5 genera of Lauraceae in China. J. Wuhan Bot. Res. 16(3): 219–222.
CCDB · book-indian_vol1 — Sugiura, T. 1931 ; Sharma, A. K. & Bhattacharyya, N.K. 19S9d ; Chuang, T.I. et al. 1963 ; Mehra, P.N. & Bawa, K.S. 1969 ; Okada, H. & Tanaka, R. 1975
CCDB · eflora
CCDB · book-fedorov — Sugiura 1931
CCDB · book-fedorov — Sharma A. K., Bhattacharyya N. K. 1959d
CCDB · book-fedorov — ChuaJl.g et al. 1963
CCDB · book-fedorov — I. 1963)
CCDB · book-atlas-flowering-plants — Sugiura 1936b
CCDB · Cave1959 — Sharma & Bhat. 1959d
GIFT · GIFT (floras)
2n 142×GoaT · Kew Plant DNA C-values Database · CCDB · kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · kew — Nagl W, Habermann T, Fusenig HP. 1977. Nuclear DNA contents four primitive angiosperms. Plant Systematics and Evolution 127: 103-105.
n 124×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +1
CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.
CCDB · book-ipcn67-71 — MEHRA, P.N., & K.S. BAWA. 1969. Chromosomal evolution in tropical hardwoods. Evolution 23: 466-481.
CCDB · book-ipcn75-78 — Mehra 1976
CCDB · Cave1963 — Chuang et al. 1963
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type13 046 records
Wild obs. + sensor10 002
Museum / vouchered2 749
Cultivated / captive7
Other288
Origin
Native20
Introduced6 639
Range
Area of Occupancy AOO18 712 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy95% within 1 km
≤100 m 6 250≤1 km 861≤10 km 224>10 km 139
7 474 georeferenced · 2 528 without coordinates
Open the mapobservation + sensor10 002
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy55% within 1 km
≤100 m 101≤1 km 87≤10 km 118>10 km 34
340 georeferenced · 2 409 without coordinates
Open the institutions mapphysical evidence2 749
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2
2 georeferenced · 5 without coordinates
Open the mapnot free-living7
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions134 of 250 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Central China Normal Universitylocation not on record | 285 |
| Beijing, CN | 178 |
| Paris, FR | 144 |
| Guangzhou, CN | 117 |
| Nanjing, CN | 103 |
| Guilin, CN | 101 |
| Brisbane, AU | 81 |
| National Museum of Natural Sciencelocation not on record | 75 |
| Kunming, CN | 60 |
| Odawara, JP | 55 |
| Smithfield, AU | 51 |
| Mount Annan, AU | 43 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 36 |
| Museo Entomologico de Leonlocation not on record | 36 |
| Jena Microbial Resource Collectionlocation not on record | 33 |
| Kochi, JP | 32 |
| Hangzhou, CN | 32 |
| Nanjing, CN | 31 |
| Sanda, JP | 30 |
| Tokushima, JP | 30 |
| Siouxland Heritage Museumlocation not on record | 29 |
| Wuhan, CN | 28 |
| Seoul, KR | 26 |
| Guangzhou, CN | 25 |
| Durban, ZA | 24 |
| Auckland, NZ | 22 |
| FFPRIlocation not on record | 21 |
| Hunan Hupingshan National Nature Reservelocation not on record | 21 |
| Chengdu, CN | 20 |
| Universidade de Passo Fundolocation not on record | 20 |
| Bando, JP | 20 |
| Jiangxi Universitylocation not on record | 19 |
| Bronx, US | 18 |
| TAIElocation not on record | 17 |
| Yangling, CN | 16 |
| Nagano City, JP | 15 |
| Xiamen, CN | 13 |
| Bangkok, TH | 13 |
| Zürich, CH | 12 |
| Universidad Católica de Santa Maríalocation not on record | 12 |
| Zhengzhou, CN | 12 |
| Miami, US | 12 |
| Cape Town, ZA | 12 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 12 |
| Museo universitario di Chietilocation not on record | 11 |
| WNNUlocation not on record | 11 |
| Taipei, TW | 11 |
| Zhejiang Museum of Natural Historylocation not on record | 11 |
| Armidale, AU | 10 |
| St. Augustine, TT | 10 |
| Canberra, AU | 10 |
| Forestry and Forest Products Research Institutelocation not on record | 9 |
| Beijing, CN | 9 |
| Guizhou Forestry Schoollocation not on record | 9 |
| Awka, NG | 9 |
| FJIDClocation not on record | 9 |
| Shanghai, CN | 9 |
| Elocation not on record | 9 |
| JP | 8 |
| Wuhan, CN | 8 |
| Riverside, US | 8 |
| TAFORI-LSRClocation not on record | 8 |
| South Kensington, GB | 8 |
| Kew, GB | 8 |
| Honolulu, US | 7 |
| Otaru, JP | 7 |
| Anhui Normal Universitylocation not on record | 7 |
| Shanghai, CN | 7 |
| Zhuzhou, CN | 7 |
| Yunnan Universitylocation not on record | 7 |
| Jiangxi Agricultural Universitylocation not on record | 7 |
| Toyama, JP | 7 |
| Canadian Department of Agriculturelocation not on record | 7 |
| Changsha, CN | 7 |
| Saint Louis, US | 6 |
| Capital Normal Universitylocation not on record | 6 |
| Jiujiang Forestry Institutelocation not on record | 6 |
| Porto Alegre, BR | 6 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 6 |
| San Diego, US | 6 |
| Zhejiang Universitylocation not on record | 6 |
| Ischia Marine Centrelocation not on record | 6 |
| Chinese Academy of Forestrylocation not on record | 6 |
| BAYLUlocation not on record | 6 |
| Guiyang, CN | 6 |
| CASlocation not on record | 6 |
| Chongqing Museumlocation not on record | 6 |
| Taipei, TW | 6 |
| Columbia, US | 6 |
| Taipei, TW | 6 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 5 |
| Guangxi Agricultural Universitylocation not on record | 5 |
| Sagamihara, JP | 5 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| Christchurch, NZ | 5 |
| Tuscaloosa, US | 5 |
| Kensington, AU | 5 |
| BISHlocation not on record | 5 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 5 |
| John T. Waterhouse Herbariumlocation not on record | 5 |
| Chengdu, CN | 4 |
| Strecker Museum, Baylor Universitylocation not on record | 4 |
| US | 4 |
| Rotorua, NZ | 4 |
| Clemson, US | 4 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 4 |
| Guiyang, CN | 4 |
| Peking Universitylocation not on record | 4 |
| University of Southern Mississippilocation not on record | 4 |
| Austin, US | 4 |
| Nagasaki University - Fisherieslocation not on record | 4 |
| Wollongong, AU | 4 |
| MAlocation not on record | 4 |
| Pretoria, ZA | 4 |
| Chicago, US | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Wuzhou, CN | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| Guatemala City, GT | 3 |
| Osaka, JP | 3 |
| Wellington, NZ | 3 |
| Hobart, AU | 3 |
| Fort Worth, US | 3 |
| GAlocation not on record | 3 |
| Bloomington, US | 3 |
| Ivano-Frankivsk, UA | 3 |
| ASUlocation not on record | 3 |
| Guiyang, CN | 3 |
| AUAlocation not on record | 3 |
| Oskarshamn, SE | 3 |
| Vancouver, CA | 3 |
| Moscow State Universitylocation not on record | 3 |
| University of Stellenboschlocation not on record | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| Chongqing, CN | 3 |
| Shenzhen, CN | 3 |
| Nanjing, CN | 3 |
| Guiyang, CN | 3 |
| Hanshan Normal Universitylocation not on record | 3 |
| Vitoria, ES | 2 |
| Claremont, US | 2 |
| Wlocation not on record | 2 |
| CSIROlocation not on record | 2 |
| San Luis Obispo, US | 2 |
| Tomioka, JP | 2 |
| Jackson, US | 2 |
| Brasília, BR | 2 |
| Berlin, DE | 2 |
| KR | 2 |
| University of North Carolina at Pembrokelocation not on record | 2 |
| Beijing Natural History Museumlocation not on record | 2 |
| GZUlocation not on record | 2 |
| Southwest Forestry Collegelocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| LDlocation not on record | 2 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 2 |
| Long Beach, US | 2 |
| SCAUlocation not on record | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Kyoto Universitylocation not on record | 2 |
| Nanyue Arboretumlocation not on record | 2 |
| Jishou Universitylocation not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Nishihara, JP | 2 |
| València, ES | 2 |
| Antiguo Cuscatlán, SV | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| Fujian Institute of Subtropical Botanylocation not on record | 2 |
| Badajoz, ES | 2 |
| EL PASO, US | 2 |
| SDFlocation not on record | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| Fukushima Universitylocation not on record | 2 |
| Turlock, US | 2 |
| Chapel Hill, US | 2 |
| Valdosta State Universitylocation not on record | 2 |
| Sendai, JP | 2 |
| Irvine, US | 2 |
| Knoxville, US | 2 |
| Mississippi State, US | 2 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Lanzhou, CN | 1 |
| UNESP-FCAVlocation not on record | 1 |
| SMMUlocation not on record | 1 |
| Loja, EC | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| KIRMlocation not on record | 1 |
| National Herbarium of São Tomé and Principelocation not on record | 1 |
| Davis, US | 1 |
| UFRRJlocation not on record | 1 |
| Chicago, US | 1 |
| La Paz, BO | 1 |
| San José, CR | 1 |
| Minia, EG | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| Tampa, US | 1 |
| College Park, US | 1 |
| Podgorica, ME | 1 |
| PUC-RSlocation not on record | 1 |
| Cambridge, US | 1 |
| Santa Maria, BR | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| nlocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| CICYTEXlocation not on record | 1 |
| Herbarium of the Kyushu University Museum (FU)location not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| Cochabamba, BO | 1 |
| Seropédica, BR | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Flagstaff, US | 1 |
| University of Hamburglocation not on record | 1 |
| Millersville, US | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| Alexandria Universitylocation not on record | 1 |
| Florida Museum of Natural Historylocation not on record | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Port Elizabeth Museum (Bayworld)location not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| South China Normal Universitylocation not on record | 1 |
| Richmond, US | 1 |
| Burlington, US | 1 |
| MeiseBGlocation not on record | 1 |
| San Jose, US | 1 |
| Batemans Bay, AU | 1 |
| SIHUlocation not on record | 1 |
| HUFDlocation not on record | 1 |
| Nanchong, CN | 1 |
| Northridge, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Los Angeles, US | 1 |
| BClocation not on record | 1 |
| NSMKlocation not on record | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Criciúma, BR | 1 |
| Guatemala, GT | 1 |
| Adelaide, AU | 1 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| UNESClocation not on record | 1 |
| UFSMlocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Maringá, BR | 1 |
| Monastir, TN | 1 |
| GZFlocation not on record | 1 |
| Palmerston, AU | 1 |
| IAPlocation not on record | 1 |
250 institutions · 2 682 of 2 749 vouchered records shown · 62 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA49 detections
Where the DNA of Cinnamomum camphora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found49
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 49 detections have coordinates
Open the map7 countries0
Riparian zone with Baccharis salicifolia, Sa…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.6 °C 8.00–24.9
Seasonal swing summer↔winter14.9 °C
Max temp (day)19.1 °C 10.0–25.6
Min temp (night)13.7 °C 5.00–23.1
Precipitation137 mm/mo 49.2–371
Air humidity62.2 % 56.9–66.3
Moisture balance136 mm/mo
Vapour deficit771 Pa 449–973
Wind speed3.40 m/s
Cloud cover38.6 % 13.1–53.1
CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.