Cineraria deltoidea

Sond. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cineraria

At a glance

Occurrence records266

Data sources9

Biological traits15

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Cineraria deltoidea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility266 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources15 traits

Occurrence & distributionGBIF266 records

Environmental DNA1 datasets · 3 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Cineraria deltoidea is a perennial flowering plant of the family Asteraceae and the genus Cineraria which is also the closest known relative of the giant Dendrosenecio of East Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology5

Plant height max0.6 m

Plant height min0.15 m

Seed mass0.345 mg

⚠ sources differ — TRY: 0.345 mg · GIFT: 0.32 mg

Seed mass max0.32 mg

Seed mass min0.32 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max1 650 m

Elevation min200 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cineraria deltoidea has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences3

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSEF538169.1 ↗732 bpSouth Africa

ACGT

GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGACCCGTGAACATGTAACAACATTT …

Cineraria deltoidea isolate KAD437 voucher L. van der Westhuizen s.n. 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cineraria deltoidea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · ipcn-api-dl — Hedberg, I. & O. Hedberg. 1977. Chromosome numbers of afroalpine and afromontane angiosperms. Bot. Not. 130: 1–24.

CCDB · book-fedorov — Turner, Lewis 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type266 records

Wild obs. + sensor20

Museum / vouchered246

Range

Area of Occupancy AOO604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 12≤1 km 1

13 georeferenced · 7 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 4≤1 km 2≤10 km 1

7 georeferenced · 239 without coordinates

Open the institutions mapphysical evidence246

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	61
Pretoria, ZA	45
Kew, GB	37
Durban, ZA	11
Stockholm, SE	10
Saint Louis, US	9
MeiseBGlocation not on record	8
Bloomington, US	7
Claremont, US	4
National Museums of Kenyalocation not on record	3
MAlocation not on record	2
Instituto de Investigação Científica Tropicallocation not on record	2
DSMlocation not on record	1
MSB-3054location not on record	1
Cape Town, ZA	1
Paris, FR	1
University of Stellenboschlocation not on record	1
Chongqing Museumlocation not on record	1
Uppsala, SE	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

20 institutions · 207 of 246 vouchered records shown · 35 without an institution code

09Environmental DNA4 detections

Where the DNA of Cineraria deltoidea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.3 °C 18.8–25.3

Seasonal swing summer↔winter10.0 °C

Max temp (day)27.9 °C 26.6–30.4

Min temp (night)14.9 °C 11.7–19.6

Precipitation40.2 mm/mo 34.5–63.7

Air humidity49.6 % 48.3–52.5

Moisture balance-98.6 mm/mo -108–-85.1

Vapour deficit1,321 Pa 1,186–1,532

Wind speed2.90 m/s 2.70–2.90

Cloud cover17.9 % 16.3–28.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)