Cilix asiatica

Bang-Haas, 1907 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Drepanidae/Cilix

At a glance

Occurrence records112

Data sources7

Biological traits0

DNA specimens10

eDNA detections10

Sources7 archives

Databases and archives Cilix asiatica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF112 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Cilix asiatica is a moth in the family Drepanidae first described by Otto Bang-Haas in 1907. It is found in Ukraine, Romania, Bulgaria, North Macedonia, Greece, Crete,Fauna Europaea the eastern parts of Turkey, Israel and Lebanon.The Drepanoidea of Israel: Distribution, Phenology and Ecology (Lepidoptera: Thyatiridae and Drepanidae), with description of a new species The habitat consists of xerothermic woodland. Adults are on wing from mid-April to early October. There are two to three generations per year. The larvae are polyphagous on a variety of Rosaceae species, including Jasminum and Rubus tomentosus, Prunus, Crataegus and Malus species. Larvae can be found from May to the end of October.Schmetterlinge und ihre Ökologie

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cilix asiatica has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

40Amostly conserved

217Gmostly conserved

265Amostly conserved

295Gmostly conserved

517Gmostly conserved

532Tmostly conserved

562Gmostly conserved

628Gmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGAATCTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.32%

Haplotypes4

BIN1

Most divergent pair0.91%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eremochroa lunatasame order8.5%Leucobrephos brephoidessame order8.7%Pardasena virgulanasame order8.8%Hypertropha chlaenotasame order8.8%Macrauzata fenestrariasame family9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type112 records

Wild obs. + sensor97

Museum / vouchered13

Other2

Origin

Native1

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 47≤1 km 23≤10 km 6>10 km 4

80 georeferenced · 17 without coordinates

Open the mapobservation + sensor97

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 1≤1 km 5≤10 km 2

8 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	5
Tartu, EE	5
ZSMlocation not on record	1
Helsinki, FI	1
Cornell University Insect Collectionlocation not on record	1

5 institutions · 13 of 13 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Cilix asiatica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

dry forest/riverbank

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 15.8–23.3

Seasonal swing summer↔winter15.3 °C

Max temp (day)25.3 °C 18.9–28.9

Min temp (night)17.8 °C 12.1–18.5

Precipitation17.9 mm/mo 12.1–39.9

Air humidity54.6 % 53.4–57.4

Moisture balance-114 mm/mo -144–-104

Vapour deficit1,177 Pa 783–1,329

Wind speed2.30 m/s 1.70–5.30

Cloud cover23.2 % 16.2–34.0

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)