Cichorium spinosum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cichorium

At a glance

Occurrence records244

Data sources14

Biological traits15

DNA specimens4

eDNA detections4

Sources14 archives

Databases and archives Cichorium spinosum's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility244 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources15 traits

Chemical compositionLOTUS · NPASS30 compounds

Occurrence & distributionGBIF244 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT1.7 Gbp

01Narrative

Cichorium spinosum, the spiny chicory, is a species of flowering plant in the family Asteraceae, native to the Mediterranean region. A biennial or perennial reaching , is both collected in the wild and cultivated as a leafy green vegetable.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology2

Plant height0.2 m

Seed mass0.69 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Lifespan years3 years

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry3

Leaf n18.7 mg/g

Leaf p2.2 mg/g

Photosynthetic pathwayC3

03Chemical composition30 compounds

Compounds documented for Cichorium spinosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cholestane steroids5

Catechols with side chains4

Stigmastane steroids4

Ursane and Taraxastane triterpenoids4

Cholestane steroids $ Stigmastane steroids4

Documented compounds30 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Clerosterol	present	NPASS
(18alpha,19alpha)-5alpha-Urs-20(30)-en-3-one	present	LOTUS
(22E,24R)-24,26-dimethylcholesta-5,22,25(27)-trien-3beta-ol	present	NPASS
(3beta,13alpha,14beta)-13-Methyl-26-norurs-7-en-3-ol	present	LOTUS
(3S,4aR,6aR,6aR,6bR,8aR,12S,12aS,14aR,14bR)-4,4,6a,6b,8a,12,14b-heptamethyl-11-methylidene-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,13,14,14a-hexadecahydropicen-3-ol	present	LOTUS
(4aR,6aR,6aS,8aR,12aS,14aR,14bR)-4,4,6a,6a,8a,11,11,14b-octamethyl-2,4a,5,6,8,9,10,12,12a,13,14,14a-dodecahydro-1H-picen-3-one	present	LOTUS
(4aR,6aS,6bS,8aR,11R,12S,12aR,14aR,14bR)-4,4,6a,6b,8a,11,12,14b-octamethyl-1,2,4a,5,7,8,9,10,11,12,12a,13,14,14a-tetradecahydropicen-3-one	present	LOTUS
22-Dehydrocholesterol	present	NPASS
24-Methylenecholesterol	present	NPASS
24-Norcholesterol	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cichorium spinosum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ746394.1 ↗639 bpGreece

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTACCTATAACCGGGAGTCAGGGGTATGGGCCTTGGCCCTATCGCTGGCACCCCGT …

Cichorium spinosum 5.8S rRNA gene, ITS1 and ITS2, specimen voucher cich-225

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Cichorium spinosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 726 170 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Cichorium spinosum1.73 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 186×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · ipcn-api-dl

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ita-fl — BRULLO S., MAJORANA G., PAVONE P., TERRASI M.C. - 1977. Numeri cromosomici per la flora italiana:283-298.. Inform. Bot. Ital. , 9(1): 40-54.

CCDB · ipcn-api-dl — Montmollin, B. d. 1986. étude cytotaxonomique de la flore de la Crète. III. Nombres chromosomiques. Candollea 41: 431–439.

CCDB · ipcn-api-dl — Brullo, S., G. MAJORANA, P. Pavone & M. C. TERRASI. 1977a. Numeri cromosomici per la flora Italiana: 283-298. Inform. Bot. Ital. 9: 40–55.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type244 records

Wild obs. + sensor153

Museum / vouchered83

Cultivated / captive2

Other6

Origin

Introduced2

Range

Area of Occupancy AOO784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 77≤1 km 26≤10 km 8

111 georeferenced · 42 without coordinates

Open the mapobservation + sensor153

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 2

8 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence83

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	46
Berlin, DE	6
BIO-UNIPIlocation not on record	3
València, ES	3
MAlocation not on record	2
Provincia di Livornolocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Wlocation not on record	2
Sevilla, ES	2
Stockholm, SE	1
Görlitz, DE	1
BRNUlocation not on record	1
Alicante, ES	1
Davis, US	1
Salamanca, ES	1
Moscow State Universitylocation not on record	1
Frankfurt am Main	1
Adam Mickiewicz University in Poznańlocation not on record	1

18 institutions · 77 of 83 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Cichorium spinosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 17.0–17.0

Seasonal swing summer↔winter16.2 °C

Max temp (day)18.5 °C

Min temp (night)14.9 °C

Precipitation55.2 mm/mo

Air humidity62.8 %

Moisture balance-51.6 mm/mo

Vapour deficit758 Pa

Wind speed3.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)