Cichorium pumilum

Jacq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cichorium

At a glance

Occurrence records815

Data sources12

Biological traits29

DNA specimens16

eDNA detections15

Sources12 archives

Databases and archives Cichorium pumilum's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility815 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources29 traits

Chemical compositionLOTUS · NPASS27 compounds

Occurrence & distributionGBIF815 records

Environmental DNA1 datasets · 9 countries15 detections

DNA & barcodingBOLD · NCBI16 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Cichorium pumilum is a Mediterranean species of plant in the tribe Cichorieae within the family Asteraceae . Like the two other species of Cichorium, its leaves are edible by humans. The plant produces bluish-violet flower heads and fleshy taproots.Altervista Flora Italiana, Endivia selvatica, Cichorium pumilum Jacq.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology7

Fruit length max2.5 mm

Fruit length min1.8 mm

Plant height max0.5 m

Plant height min0.15 m

Seed mass73.71 mg

Seed mass max73.71 mg

Seed mass min73.71 mg

Life cycle & reproduction9

Dehiscenceindehiscent

Flower colourblue

Flower width max35 mm

Flower width min30 mm

Flowering endJul

Flowering startApr

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 400 m

Elevation min0 m

Epiphyteterrestrial

Fruit colourblack

Fruit typeachene

Growth formherb

Habitat GIFTcropfields,inhabitedplaces,mountains,oldfields,parks

Leaf formovate

Woodinessnon-woody

03Chemical composition27 compounds

Compounds documented for Cichorium pumilum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Guaiane sesquiterpenoids13

Cinnamic acids and derivatives3

Ursane and Taraxastane triterpenoids2

Flavonols2

Eudesmane sesquiterpenoids1

Documented compounds27 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R,4S,5S,6R)-2-[[(3S,4aR,6aR,6aR,6bR,8aR,12S,12aR,14aR,14bR)-4,4,6a,6b,8a,12,14b-heptamethyl-11-methylidene-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,13,14,14a-hexadecahydropicen-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(3aR,4S,9aR,9bR)-4-hydroxy-9-(hydroxymethyl)-6-methyl-3-methylidene-4,5,9a,9b-tetrahydro-3aH-azuleno[4,5-b]furan-2,7-dione	present	LOTUS
(3aS,6S,6aS,9bS)-6-hydroxy-6,6a,9-trimethyl-3-methylidene-3a,4,5,7,8,9b-hexahydroazuleno[4,5-b]furan-2-one	present	LOTUS
(3aS,6S,6aS,9bS)-6-hydroxy-6,9-dimethyl-3-methylidene-4,5,6a,7,8,9b-hexahydro-3aH-azuleno[4,5-b]furan-2-one	present	LOTUS
(3S,3aS,6S,6aS,9bS)-6-hydroxy-3,6,6a,9-tetramethyl-3a,4,5,7,8,9b-hexahydro-3H-azuleno[4,5-b]furan-2-one	present	LOTUS
(3S,3aS,6S,6aS,9bS)-6-hydroxy-3,6,9-trimethyl-3,3a,4,5,6a,7,8,9b-octahydroazuleno[4,5-b]furan-2-one	present	LOTUS
(3S,4aR,6aR,6aR,6bR,8aS,10R,12S,12aR,14aR,14bR)-4,4,6a,6b,8a,12,14b-heptamethyl-11-methylidene-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,13,14,14a-hexadecahydropicene-3,10-diol	present	LOTUS
11beta,13-Dihydrolactucin	present	LOTUS
2-Isopropyl-6-methyl-4-pyrimidinol	present	LOTUS
2-Propenoic acid, 3-(3,4-dihydroxyphenyl)-, ethyl ester	present	LOTUS

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cichorium pumilum has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes4

GenBank sequences10

eDNA detections15

Countries10

The DNA barcodea real sequence read deposited for this species

ITSAY218947.1 ↗640 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTACCTATAACCGGGAGTCAGGGGTACGGGCCTTTGCCCTATCGCTGGCACCCCGT …

Cichorium pumilum clone CICP internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS10★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cichorium pumilum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 186×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ita-fl — RICCI I. - 1966. Cichorium intybus L. ssp. spicatum Ricci.. Giorn. Bot. Ital. , 73(1-2): 91-92.

CCDB · ita-fl — RICCI I. - 1964. Cichorium intybus L. ssp. spicatum, ssp. nova. Studio citotassonomico.. Ann. Bot. (Rome) , 28(1): 219-273.

CCDB · ipcn-api-dl — Nazarova, E. A. 1984. Chromosome numbers in the Caucasian representatives of the families Asteraceae, Brassicaceae, Fabaceae, Limoniaceae. Bot. Zhurn. SSSR 69(7): 972–975. (In Russian).

CCDB · ipcn-api-dl — Nazarova. 2004. Pages 1--171 in Chromosome Numbers of Flowering Plants of Armenian Flora. Yerevan.

CCDB · book-ipcn67-71 — RICCI, I. 1964. Cichorium intybus L. subsp. spicatum subsp. nova. Studio citotassinomico. Ann. di Bot. 28: 219-224.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type815 records

Wild obs. + sensor604

Museum / vouchered211

Origin

Native28

Range

Area of Occupancy AOO2 544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 207≤1 km 82≤10 km 223>10 km 8

520 georeferenced · 84 without coordinates

Open the mapobservation + sensor604

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 9≤1 km 28≤10 km 25

62 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence211

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	53
BClocation not on record	37
Berlin, DE	32
València, ES	10
Granada, ES	9
PRClocation not on record	6
Wlocation not on record	4
Moscow State Universitylocation not on record	4
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
MAlocation not on record	3
Paris, FR	3
Bratislava, SK	3
Sevilla, ES	2
Museo Achille Folettolocation not on record	2
ISAlocation not on record	2
Brussel, BE	2
Finnish Museum of Natural History, Botanical Museumlocation not on record	1
Xiamen, CN	1
Alicante, ES	1
Bronx, US	1
CICYTEXlocation not on record	1
Badajoz, ES	1
Beijing, CN	1
SLU Artdatabankenlocation not on record	1
Stockholm, SE	1
UIBlocation not on record	1
Helsinki, FI	1
Uppsala, SE	1
GZUlocation not on record	1

29 institutions · 188 of 211 vouchered records shown · 14 without an institution code

09Environmental DNA15 detections

Where the DNA of Cichorium pumilum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 13.8–24.2

Seasonal swing summer↔winter20.9 °C

Max temp (day)21.2 °C 17.7–30.3

Min temp (night)12.2 °C 8.60–16.3

Precipitation31.7 mm/mo 8.50–72.5

Air humidity50.5 % 43.6–63.1

Moisture balance-99.9 mm/mo -165–-17.1

Vapour deficit1,103 Pa 722–1,879

Wind speed4.20 m/s 3.00–4.90

Cloud cover38.2 % 23.9–42.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)