Cichorium intybus
speciesAt a glance
Occurrence records324 282
Data sources18
Biological traits139
DNA specimens131
eDNA detections146
Sources18 archives
Databases and archives Cichorium intybus's data was compiled from.
WikipediaWikimedia Foundation18 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility324 282 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI146 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics131 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
FooDBThe Metabolomics Innovation Centrecompounds↗
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources139 traits
Chemical compositionDukesPhytochem · FooDB · FoodAtlas · LOTUS · NPASS6 052 compounds
Occurrence & distributionGBIF324 282 records
Environmental DNA3 datasets · 29 countries146 detections
DNA & barcodingBOLD · NCBI131 specimens
Genome at a glanceCCDB · GoaT · NCBI1.3 Gbp
01Narrative
Common chicory (Cichorium intybus) is a somewhat woody, perennial herbaceous plant of the family Asteraceae, usually with bright blue flowers, rarely white or pink. Native to the Old World, it has been introduced to North America and Australia. Many varieties are cultivated for salad leaves, chicons (blanched buds), or roots (var. sativum), which are baked, ground, and used as a coffee substitute and food additive. In the 21st century, inulin, an extract from chicory root, has been used in food manufacturing as a sweetener and source of dietary fiber. Chicory is grown as a forage crop for livestock. "Chicory" is also the common name in the United States for curly endive (Cichorium endivia); these two closely related species are often confused.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology21
Fruit length2.5 mm
Fruit length max50 mm
Fruit length min25 mm
Leaf length195 mm
⚠ sources differ — AusTraits: 195 mm · GIFT: 245 mm
Leaf length max340 mm
Leaf length min70 mm
Leaf mass556 mg
Leaf size17 537 mm²
Leaf width50 mm
⚠ sources differ — AusTraits: 50 mm · GIFT: 30 mm
Leaf width max120 mm
Leaf width min10 mm
Plant height0.684 m
⚠ sources differ — GIFT: 0.684 m · AusTraits: 1.35 m · LEDA: 0.625 m · USDA: 0.61 m · TRY: 0.4 m
Plant height generative0.983 m
Plant height max11.5 m
Plant height min0.15 m
Seed length3 mm
⚠ sources differ — TRY: 3 mm · GIFT: 2.7 mm
Seed length max2.7 mm
Seed length min2.7 mm
Seed mass1.15 mg
⚠ sources differ — TRY: 1.15 mg · LEDA: 1.99 mg · GIFT: 3.67 mg
Seed mass max44.21 mg
Seed mass min0.74 mg
Life cycle & reproduction38
After harvest regrowth rateSlow
Bloom periodMid Summer
Coppice potentialNo
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flower colourblue
Flower conspicuousYes
Flowering endAug
Flowering startJul
Flowering timeyynnnnnnyyyy
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: perennial · LEDA: poly-annuals < 5 years (short-lived perennials) · GIFT: perennial
Lifespan categoryShort
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number8 698
Seed spread rateRapid
Seedling vigorHigh
Self fertilizationpresent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment31
Active growth periodSummer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 500 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Fruit typeachene
Growth formherb
Growth form USDABunch
Habitat GIFTLowland
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Leaf shapeoblanceolate
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry26
Anaerobic toleranceLow
C:N ratioMedium
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementHigh
Fire resistantNo
Fire toleranceMedium
Frost free days min90 days
Leaf C:N ratio18.99 g/g
Leaf c412 mg/g
Leaf dry-matter content (LDMC)185 mg/g
⚠ sources differ — TRY: 185 mg/g · LEDA: 136 mg/g
Leaf n29.72 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min20 in
Protein potentialLow
Salinity toleranceNone
Seed longevity index0
Shade toleranceHigh
Soil pH max7.5 pH
Soil pH min6 pH
Specific leaf area (SLA)16.03 mm²/mg
⚠ sources differ — TRY: 16.03 mm²/mg · LEDA: 28.56 mm²/mg · GIFT: 26.43 mm²/mg
Temperature min-43 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound426 400 per lb
ToxicityNone
Veneer productNo
Other traits6
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Seeds per fruit>1000
03Chemical composition6 052 compounds
Compounds documented for Cichorium intybus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingVegetables
Compound class profile5 classes
Aminoacids166
Guaiane sesquiterpenoids78
Cinnamic acids and derivatives74
Glycerophospholipids57
Flavonols48
Documented compounds6 052 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| WATER | 951,000 ppm | DukesPhytochem | |
| CARBOHYDRATES | 875,500 ppm | DukesPhytochem | |
| INULIN | 850,000 ppm | DukesPhytochem | |
| SUGARS | 585,000 ppm | DukesPhytochem | |
| PROTEIN | 246,000 ppm | DukesPhytochem | |
| FRUCTOSE | 220,000 ppm | DukesPhytochem | |
| ASH | 180,000 ppm | DukesPhytochem | |
| FIBER | 153,000 ppm | DukesPhytochem |
05DNA & barcoding131 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cichorium intybus has left across the world's sequence archives.
At a glance
DNA specimens131
Marker genes11
GenBank sequences10
eDNA detections146
Countries29
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCA …
Cichorium intybus var. intybus voucher PLT.0032 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL2★rbcLa★trnL-F★ITS5★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Cichorium intybus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 310 520 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cichorium intybus1.31 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records16–202n range18median18mode75records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1867×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +13
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Hindáková M., 2007: [New records in Anagallis and Cichorium], pp. 87, 194. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · iber-fl — Chromosome numbers of vascular plants from Austria, Mallorca and Yugoslavia. Nilsson, O. & P. Lassen.Bot. Not.124: 270-276(1971).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3885
CCDB · poland — Skali?ska M. et al. 1964. Additions to chromosome numbers of Polish Angiosperms (Fifth contribution). Acta Soc. Bot. Pol. 33, 45-76.
CCDB · ipcn-api-dl — Sokolovskaya, A. P., N. S. Probatova & E. G. Rudyka. 1985. Chromosome numbers in the species of the families Asteraceae, Poaceae, Rosaceae from the Primorye Region, Kamchatka and Sakhalin. Bot. Zhurn. SSSR 70(1): 126–128.
CCDB · ipcn-api-dl — Haque, M. S. & M. B. E. Godward. 1985. Comparison between two genera, species and cultivars in Lactuceae 1. Karyotype analysis. Cytologia 50: 725–738.
CCDB · ipcn-api-dl — Haque, M. S. & M. B. E. Godward. 1986. Comparison between two genera, species and cultivars in Lactuceae III. DNA amount and radiosensitivity. Cytologia 51: 341–348.
CCDB · ipcn-api-dl — Ma, X. H., R. L. Qin & W. B. Xing. 1984. Chromosome observations of some medical plants in Xinjiang. Acta Phytotax. Sin. 22: 243–249.
CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
CCDB · ipcn-api-dl — Kliphuis, E. & Y. I. Barkoudah. 1977. Chromosome numbers in some Syrian angiosperms. Acta Bot. Neerl. 26: 239–249.
CCDB · ipcn-api-dl — Nazarova. 2004. Pages 1--171 in Chromosome Numbers of Flowering Plants of Armenian Flora. Yerevan.
CCDB · ipcn-api-dl — Pacheco. 2004. Números cromosómicos para la flora Española. 819--830. Lagascalia 24: 175–182.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-ipcn67-71 — PODLECH, D., & A. DIETERLE. 1969. Chromosomenstudien an afghanischen Pflanzen. Candollea 24: 185-243.
CCDB · book-ipcn67-71 — KUZMANOV, B.A., & S.I. KOZUHAROV. 1970. In IOPB chromosome number reports XXVI. Taxon 19: 264-269.
CCDB · book-ipcn67-71 — MURIN, A., & M.Y. SHEIKH. 1971. In IOPB chromosome reports XXXII. Taxon 20: 349-356.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dJ spermatophyta de Portugal. 47(Ser. 2l: 299-314. II Compositae, supl. I Bol. Soc. Brot. I
CCDB · book-ipcn73-74 — NILSSON, Q., & P. LASSEN. 1971. Chromosome numbers of vascular pla from Austria, Mallorca and Yugoslav1a. Bot. Not1ser 124: 270-276. I
CCDB · book-indian_vol1 — Makoveltski, M. (Fedorov) ; Tischler, G. 1934; Delay, C. 1947; Heiser, C.B. & Whitaker, T.W. 1948 ; Singh, B. 1951; Rick, C.M. 1953; Stebbins, G. L. et al. 1953 ; Mehra, P.N. & Sidhu, S.S. 1960; Koul, M.L.H. 1964a ; Skalinska, M. et al. 1964 ; Mehra, P. N. et al. 1965 ; Podlech, D. & Dieterle, A. 1969 ; Kuzmanov, B.A. & Kozuha- rov, S. I. 1970; Murin, A. & Sheikh, M. Y. 1971 ; Kaul, V. & Singh, D. 1972 ; Remanandan, P. & Mehra, P.N. 1974; Kliphuis, E. 1977; Tomb, A.S. et al. 1978 ; Jansen, R.K. & Stuessy, T. F. 1980 ; Bir, S.S. & Sidhu, M. 1980; Van Loon, J. Chr. & Kieft, B. 1980
CCDB · eflora
CCDB · book-fedorov — MaROBe~ 1929
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Heiser, Whitaker 1948
CCDB · book-fedorov — Singh B. 1951
CCDB · book-fedorov — Rick 1953
+27 more references
2n 164×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.
CCDB · ipcn-api-dl — Harriman, N. A. 1981. In Chromosome number reports LXX. Taxon 30: 77–78.
CCDB · CromoCat 2015 — Dmitrieva, S. A. (1987). Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23-33.
CCDB · CromoCat 2015 — Harriman, N. A. (1981a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXX]. Taxon 30(1): 77-78.
2n 204×CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-indian_vol1 — Majovsky, J, et al. 1970b; Ferakova, V. 1972
CCDB · CromoCat 2015 — Javorcikova, D. (1970). B-chromosomes in Cichorium intybus L. from Slovak localities. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 16: 73-76.
CCDB · CromoCat 2015 — Uhríková, A. & A. Murín. (1970). Reports (In Májovsky, J. & al. (ed.), Index of chromosome numbers of slovakian flora. Part 2). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 18: 45-60.
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Razaq, Z. A., A. A. Vahidy & S. I. Ali. (1994). Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800-808.
n 916×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +1
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Ghaffari, S. M. 1989. Chromosome studies in Iranian Compositae. Iran. J. Bot. 4: 189–196.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — Sidhu, M. K. 1979. Distributional and cytological studies of the weed flora of cultivable fields of Patiala district (Panjab). Ph.D. Thesis, Patiala. 1-230. 1979.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.
CCDB · ipcn-api-dl — Harriman, N. A. 1981. In Chromosome number reports LXX. Taxon 30: 77–78.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
CCDB · ipcn-api-dl — Tomb, A. S., K. L. Chambers, D. W. KYHOS, A. M. Powell & P. H. RAVEN. 1978. Chromosome numbers in the Compositae XIV. Lactuceae. Amer. J. Bot. 65: 717–721.
CCDB · book-ipcn73-74 — WATSON, T.J., Jr. 1973. Chromosome numbers in Compositae from the southwestern United states. Southw. Naturalist 18: 117-124.
CCDB · book-ipcn73-74 — KAUL, V., & D. SINGH. 1972. Cytological studies in some members of Cichorieae (Compositael. Proc. Indian Sci. Congr. Assoc. 59( III): 366.
CCDB · CromoCat 2015 — Harriman, N. A. (1981a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXX]. Taxon 30(1): 77-78.
CCDB · CromoCat 2015 — Mehra, P. N., B. S. Gill, J. K. Mehta & S. S. Sidhu. (1965a). Cytological investigations on the Indian Compositae. I. North Indian taxa. Caryologia 18: 35-68.
CCDB · CromoCat 2015 — Razaq, Z. A., A. A. Vahidy & S. I. Ali. (1994). Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800-808.
n 05×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
CCDB · CromoCat 2015 — Harriman, N. A. (1981a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXX]. Taxon 30(1): 77-78.
CCDB · CromoCat 2015 — Nazarova. (2004). Chromosome Numbers of Flowering Plants of Armenian Flora. 1-171 Yerevan
CCDB · CromoCat 2015 — Pacheco. (2004). Números cromosómicos para la flora Española. 819–830. Lagascalia 24: 175–182.
CCDB · CromoCat 2015 — Javorcikova, D. & Murin, A. (1974). In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness97.5% BUSCO
07Deep time~1.08 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin1.08 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type324 282 records
Wild obs. + sensor311 013
Museum / vouchered11 317
Cultivated / captive198
Other1 754
Origin
Native3 379
Introduced4 702
Range
Area of Occupancy AOO500 404 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy55% within 1 km
≤100 m 102 708≤1 km 31 945≤10 km 106 951>10 km 4 512
246 116 georeferenced · 64 897 without coordinates
Open the mapobservation + sensor311 013
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy41% within 1 km
≤100 m 699≤1 km 2 018≤10 km 3 684>10 km 273
6 674 georeferenced · 4 643 without coordinates
Open the institutions mapphysical evidence11 317
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy4% within 1 km
≤1 km 4≤10 km 80>10 km 13
97 georeferenced · 101 without coordinates
Open the mapnot free-living198
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions240 of 428 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 458 |
| BFLlocation not on record | 457 |
| BIO-UNIPIlocation not on record | 454 |
| Berlin, DE | 283 |
| LDlocation not on record | 281 |
| Philadelphia, US | 272 |
| Moscow State Universitylocation not on record | 260 |
| Olocation not on record | 220 |
| Uniwersytet Warszawskilocation not on record | 195 |
| Chongqing Museumlocation not on record | 154 |
| Madison, US | 149 |
| Québec, CA | 114 |
| Mount Annan, AU | 97 |
| Bronx, US | 93 |
| Wuzhou, CN | 87 |
| Salzburg, AT | 85 |
| SLU Artdatabankenlocation not on record | 83 |
| MeiseBGlocation not on record | 79 |
| Adelaide, AU | 75 |
| IFR-DNFlocation not on record | 73 |
| Lausanne, CH | 66 |
| Oskarshamn, SE | 66 |
| València, ES | 64 |
| BClocation not on record | 64 |
| Museo Entomologico de Leonlocation not on record | 63 |
| Canberra, AU | 61 |
| MAlocation not on record | 55 |
| Brisbane, AU | 55 |
| Ann Arbor, US | 54 |
| Adam Mickiewicz University in Poznańlocation not on record | 53 |
| Montréal, CA | 53 |
| Bloomington, US | 52 |
| Saint Louis, US | 52 |
| Tartu, EE | 50 |
| BDBClocation not on record | 49 |
| Beijing, CN | 47 |
| WTUlocation not on record | 45 |
| Trondheim, NO | 43 |
| Pullman, US | 42 |
| Burlington, US | 42 |
| Williamsburg, US | 42 |
| Allentown, US | 41 |
| Bern, CH | 41 |
| University of Stellenboschlocation not on record | 40 |
| Görlitz, DE | 39 |
| Provincia di Livornolocation not on record | 39 |
| ISAlocation not on record | 37 |
| GMBAlocation not on record | 37 |
| Millersville, US | 36 |
| Davis, US | 35 |
| Université Lavallocation not on record | 35 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 34 |
| Wellington, NZ | 33 |
| Riverside, US | 33 |
| South Kensington, GB | 33 |
| Chadron, US | 32 |
| College Park, US | 32 |
| New Haven, US | 32 |
| Santa Barbara, US | 32 |
| Claremont, US | 31 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 30 |
| College of the Atlantic, Museumlocation not on record | 28 |
| Yangling, CN | 28 |
| San Diego, US | 28 |
| KMNlocation not on record | 27 |
| Flagstaff, US | 27 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 27 |
| Moscow, US | 27 |
| CICYTEXlocation not on record | 27 |
| Acadia Universitylocation not on record | 26 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 26 |
| Saint John, CA | 25 |
| University of New Hampshirelocation not on record | 25 |
| Hobart, AU | 25 |
| Spearfish, US | 25 |
| Canadian Department of Agriculturelocation not on record | 25 |
| Córdoba, AR | 24 |
| Kuopio, FI | 24 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 24 |
| Oulu, FI | 23 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 23 |
| McWane Science Centerlocation not on record | 23 |
| Bergen, NO | 23 |
| Vancouver, CA | 23 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 22 |
| Wlocation not on record | 22 |
| St. Paul, US | 22 |
| Bozeman, US | 22 |
| BRNUlocation not on record | 22 |
| Salamanca, ES | 21 |
| Corvallis, US | 21 |
| CJBGlocation not on record | 21 |
| Jyväskylä, FI | 21 |
| Tallinn, EE | 20 |
| Denver, US | 20 |
| Uppsala, SE | 19 |
| Auckland, NZ | 19 |
| Green Bay, US | 18 |
| Turku, FI | 18 |
| Mlocation not on record | 18 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 18 |
| Entomological Society of Latvialocation not on record | 17 |
| Madrid, ES | 17 |
| Jaén, ES | 17 |
| Sevilla, ES | 17 |
| Pamplona, ES | 16 |
| Lord Fairfax Community Collegelocation not on record | 16 |
| Bangkok, TH | 15 |
| UChlocation not on record | 15 |
| Dekalb, US | 15 |
| Albuquerque, US | 14 |
| Missoula, US | 14 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 14 |
| WNNUlocation not on record | 14 |
| Barcelona, ES | 14 |
| Pittsburg, US | 14 |
| UIBlocation not on record | 14 |
| Christchurch, NZ | 14 |
| San Isidro, AR | 13 |
| Toronto, CA | 13 |
| AZE015location not on record | 13 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 13 |
| New Brunswick, US | 12 |
| CASlocation not on record | 12 |
| Badajoz, ES | 12 |
| Urumqi, CN | 12 |
| ASUlocation not on record | 12 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| Kensington, AU | 12 |
| San Sebastián, ES | 12 |
| Tula State Universitylocation not on record | 12 |
| Columbia, US | 11 |
| Angwin, US | 11 |
| TUR-Alocation not on record | 11 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 11 |
| Morgantown, US | 11 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 11 |
| Kew, GB | 11 |
| Rotorua, NZ | 11 |
| Frankfurt am Main | 10 |
| Logan, US | 10 |
| Karlsruhe, DE | 10 |
| Zürich, CH | 10 |
| KIRMlocation not on record | 10 |
| Keene State Universitylocation not on record | 9 |
| Armidale, AU | 9 |
| Staten Island, US | 9 |
| Alicante, ES | 9 |
| Jackson, US | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| Whitewater, US | 9 |
| Fayetteville, US | 9 |
| Helsinki, FI | 9 |
| Fort Worth, US | 9 |
| San Luis Obispo, US | 9 |
| Emporia, US | 9 |
| Palacký University in Olomouclocation not on record | 9 |
| Chapel Hill, US | 8 |
| Knoxville, US | 8 |
| Grand Junction, US | 8 |
| Arcata, US | 8 |
| Victoria, CA | 8 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 8 |
| Durango, US | 8 |
| San Francisco, US | 8 |
| Austin, US | 7 |
| Hudson, US | 7 |
| Museum of the Rockieslocation not on record | 7 |
| Lanzhou, CN | 7 |
| Fredericksburg, US | 7 |
| Lincoln, US | 7 |
| DOI/NPS, Greenbelt Parklocation not on record | 7 |
| Uniwersytet Opolskilocation not on record | 7 |
| Vitoria, ES | 7 |
| University of Guelph, OAC Herbariumlocation not on record | 7 |
| Ypsilanti, US | 7 |
| Boise, US | 7 |
| Paris, FR | 7 |
| Guangzhou, CN | 6 |
| Norfolk, US | 6 |
| Minia, EG | 6 |
| University of Genevalocation not on record | 6 |
| Porrentruy, CH | 6 |
| Mexico City, MX | 6 |
| Washington, US | 6 |
| PrivatHerblocation not on record | 6 |
| Granada, ES | 6 |
| Johnson City, US | 6 |
| ESP026location not on record | 6 |
| EL PASO, US | 6 |
| Chengdu, CN | 6 |
| University of Alberta Museumslocation not on record | 6 |
| Phoenix, US | 6 |
| Caldwell, US | 6 |
| Henderson State Universitylocation not on record | 5 |
| Mexico City, MX | 5 |
| Otaru, JP | 5 |
| Xining, CN | 5 |
| Pocatello, US | 5 |
| Córdoba, ES | 5 |
| GJOlocation not on record | 5 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 5 |
| POL003location not on record | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| Chiba, JP | 5 |
| Porvoo, FI | 5 |
| Mississippi State, US | 5 |
| Frauenfeld, CH | 5 |
| Winterthur, CH | 5 |
| TROMlocation not on record | 5 |
| Stockholm, SE | 5 |
| Batemans Bay, AU | 5 |
| US | 5 |
| Glarus, CH | 5 |
| DBF-NHMDlocation not on record | 5 |
| Fairfax, US | 5 |
| Dover, US | 5 |
| SIHUlocation not on record | 4 |
| Bourges, FR | 4 |
| UGentlocation not on record | 4 |
| Jefferson City, US | 4 |
| Kirksville, US | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Dresden, DE | 4 |
| Provo, US | 4 |
| Taipei, TW | 4 |
| Durango, MX | 4 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 4 |
| San Angelo, US | 4 |
| Blumenau, BR | 4 |
| Kingston, US | 4 |
| ESP027location not on record | 4 |
| Laboratory of Palaeontologylocation not on record | 4 |
| BSBIlocation not on record | 4 |
| Phyletisches Museum Jenalocation not on record | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Portland, US | 4 |
| Nishihara, JP | 4 |
| Hamilton, US | 4 |
| Miami, US | 4 |
| SZUlocation not on record | 4 |
| Beijing, CN | 4 |
| Lubbock, US | 4 |
| GZUlocation not on record | 4 |
| Parkville, AU | 4 |
| Turlock, US | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Philadelphia, US | 3 |
| Weber State Universitylocation not on record | 3 |
| Maringá, BR | 3 |
| Universite de Montpellierlocation not on record | 3 |
| Taipei, TW | 3 |
| Tuscaloosa, US | 3 |
| JBSlocation not on record | 3 |
| Chicago, US | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| Orem, US | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Bend, US | 3 |
| Palmerston North, NZ | 3 |
| Northridge, US | 3 |
| Tilburg, NL | 3 |
| Springfield, US | 3 |
| Université de Bordeauxlocation not on record | 3 |
| Western Carolina Universitylocation not on record | 3 |
| IDElocation not on record | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| Bandelier National Monumentlocation not on record | 3 |
| Little Rock, US | 3 |
| Davenport, US | 3 |
| Harrisonburg, US | 3 |
| Tacoma, US | 3 |
| Nagano City, JP | 3 |
| Shinshu Universitylocation not on record | 3 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 2 |
| Göteborg, SE | 2 |
| QAUlocation not on record | 2 |
| Taipei, TW | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Smithfield, AU | 2 |
| Viña del Mar, CL | 2 |
| Pamplona, ES | 2 |
| QVMAGlocation not on record | 2 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 2 |
| Honolulu, US | 2 |
| UFOPlocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| WINlocation not on record | 2 |
| Philadelphia, US | 2 |
| Xiamen, CN | 2 |
| Richmond, US | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Macomb, US | 2 |
| Los Angeles, US | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| Guatemala City, GT | 2 |
| nbflocation not on record | 2 |
| Mount Pleasant, US | 2 |
| Umeå Universitylocation not on record | 2 |
| China Agricultural Universitylocation not on record | 2 |
| Tsukuba, JP | 2 |
| Baltimore, US | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Chicago, US | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| Cheney, US | 2 |
| GB | 2 |
| Ashland, US | 2 |
| Forssa, FI | 2 |
| HUN003location not on record | 2 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 2 |
| EEZA-CSIClocation not on record | 2 |
| Bando, JP | 2 |
| CZE061location not on record | 2 |
| GBR006location not on record | 2 |
| Mohonk Preservelocation not on record | 2 |
| Bothell, US | 2 |
| Torreón, MX | 2 |
| Montecillo, Texcoco, MX | 2 |
| Chicago, US | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Santa Cruz, US | 2 |
| H-Wolflocation not on record | 2 |
| Durham, US | 2 |
| Irvine, US | 2 |
| US | 2 |
| Odawara, JP | 2 |
| Waverly, US | 2 |
| Santa Teresa, BR | 1 |
| Edinburgh, GB | 1 |
| Fribourg, CH | 1 |
| Sion, CH | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Decorah, US | 1 |
| PHlocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| SEFlocation not on record | 1 |
| Tampa, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Zapopan, MX | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| UnBlocation not on record | 1 |
| Universidade Federal do Maranhãolocation not on record | 1 |
| OLAlocation not on record | 1 |
| MMHNSRlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| ROM007location not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Portland, US | 1 |
| Brown Universitylocation not on record | 1 |
| ESP004location not on record | 1 |
| Campo Mourão, BR | 1 |
| Porto Velho, BR | 1 |
| La Paz, BO | 1 |
| US | 1 |
| UoB-IBlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Brussel, BE | 1 |
| Pelotas, BR | 1 |
| Clemson, US | 1 |
| Cincinnati, US | 1 |
| H-Hohlalocation not on record | 1 |
| ESP109location not on record | 1 |
| Sanda, JP | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Montréal, CA | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Pretoria, ZA | 1 |
| Trois-Rivières, CA | 1 |
| UEMlocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Valparaíso, CL | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| USFSlocation not on record | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Coimbra, PT | 1 |
| UTFPR-DVlocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Corrientes, AR | 1 |
| Fukushima Universitylocation not on record | 1 |
| CBDClocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| National Institute for Agricultural and Veterinarian Research, Portugallocation not on record | 1 |
| Kunming, CN | 1 |
| FLADlocation not on record | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
| RJBJCIlocation not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Namur, BE | 1 |
| University of Southern Mississippilocation not on record | 1 |
| San Jose, US | 1 |
| Chengdu, CN | 1 |
| Zhuzhou, CN | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| Xian, CN | 1 |
| Sagamihara, JP | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Tempe, US | 1 |
| INMAlocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| Firenze, IT | 1 |
| UNESP-RClocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| UNEMATlocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| GAlocation not on record | 1 |
428 institutions · 10 164 of 11 317 vouchered records shown · 866 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA146 detections
Where the DNA of Cichorium intybus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found146
Studies independent surveys3
Countries29
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 146 detections have coordinates
Open the map29 countries0
nursery greenhouseRiparian and oak woodland Quercus agrifolia,…Urban parks and large gardens
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.6 °C 9.80–23.2
Seasonal swing summer↔winter21.5 °C
Max temp (day)20.8 °C 13.0–31.2
Min temp (night)14.0 °C 4.60–15.3
Precipitation57.6 mm/mo 3.70–93.7
Air humidity56.8 % 44.4–62.8
Moisture balance-51.6 mm/mo -167–6.20
Vapour deficit857 Pa 471–1,580
Wind speed2.40 m/s 1.80–4.30
Cloud cover34.3 % 14.7–42.8
CHELSA 1981–2010, ~9 km grid, at location & month of 119 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.