Cichorium glandulosum

Boiss. & A.Huet · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Cichorium

At a glance

Occurrence records47

Data sources7

Biological traits21

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Cichorium glandulosum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources21 traits

Chemical compositionLOTUS · NPASS148 compounds

Occurrence & distributionGBIF47 records

DNA & barcodingNCBIsequences

01Narrative

Cichorium glandulosum — вид квіткових рослин з родини айстрових (Asteraceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology11

Fruit length2.75 mm

Fruit length max3.5 mm

Fruit length min2 mm

Leaf length140 mm

Leaf length max145 mm

Leaf length min135 mm

Leaf width35 mm

Leaf width max40 mm

Leaf width min30 mm

Plant height max0.7 m

Plant height min0.2 m

Life cycle & reproduction5

Flowering endSep

Flowering startJun

Life formannual

Life spanannual

Raunkiær life formtherophyte

Habitat & environment5

Climatetemperate

Climberself-supporting

Growth formherb

Habitat GIFTmountains

Woodinessnon-woody

03Chemical composition148 compounds

Compounds documented for Cichorium glandulosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives27

Flavonols14

Pseudoguaiane sesquiterpenoids13

Anthocyanidins12

Guaiane sesquiterpenoids11

Documented compounds148 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Chicoricacid	present	NPASS
(+)-germacrene A	present	NPASS
(+)-Shikimic acid	present	NPASS
(-)-Chicoric acid	present	NPASS
(-)-Germacrene A	present	NPASS
(1R,3S,4S,5S)-1,3,4-trihydroxy-5-[(E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoyl]oxycyclohexane-1-carboxylic acid	present	NPASS
(1R,3S,4S,5S)-3-((E)-3-(3,4-Dihydroxyphenyl)Acryloyloxy)-1,4,5-Trihydroxycyclohexanecarboxylic Acid	present	NPASS
(1S,3S,4R,5S)-3-[(Z)-3-(3,4-Dihydroxyphenyl)prop-2-enoyl]oxy-1-[(E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]oxy-4,5-dihydroxycyclohexane-1-carboxylic acid	present	NPASS
(2R,3R,4S,5S,6R)-2-[[(3S,4aR,6aR,6aR,6bR,8aR,12S,12aR,14aR,14bR)-4,4,6a,6b,8a,12,14b-heptamethyl-11-methylidene-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,13,14,14a-hexadecahydropicen-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,5S)-2-[2-(3,4-dihydroxyphenyl)-5,7-dihydroxychromenylium-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cichorium glandulosum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences7

The DNA barcodea real sequence read deposited for this species

ITSKF241286.1 ↗453 bp

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATC …

Cichorium glandulosum voucher 20120703189 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type47 records

Wild obs. + sensor2

Museum / vouchered21

Other24

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 21 records without

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record	10
Urumqi, CN	4
Chengdu, CN	2
Yangling, CN	2
Wuhan, CN	1
FJIDClocation not on record	1

6 institutions · 20 of 21 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)