Cibotium taiwanense — The Life Data

Plantae/Tracheophyta/Polypodiopsida/Cyatheales/Cibotiaceae/Cibotium

At a glance

Occurrence records717

Data sources4

Biological traits2

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Cibotium taiwanense's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility717 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF717 records

DNA & barcodingNCBIsequences

01Narrative

Cibotium taiwanense is a species in the genus Cibotium, endemic to Taiwan. Some sources regard it as the same species as Cibotium cumingii.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formperennial

Habitat & environment1

Climatesubtropical

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cibotium taiwanense has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPP559814.1 ↗1 299 bpTaiwan

ACGT

GCTGGTGTTAAAGATTATCGGTTGACCTATTACACTCCCGATTATAAGACCAAAGACACCGATATCTTGGCAGCCTTTCGAATGACCCCG …

Cibotium taiwanense voucher TAIF:Kuo3375 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

08Occurrence & distribution

Record type717 records

Wild obs. + sensor462

Museum / vouchered243

Other12

Origin

Native23

Range

Area of Occupancy AOO1 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 235≤1 km 39≤10 km 26>10 km 3

303 georeferenced · 159 without coordinates

Open the mapobservation + sensor462

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 2

4 georeferenced · 239 without coordinates

Open the institutions mapphysical evidence243

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	187
TAIElocation not on record	23
National Museum of Natural Sciencelocation not on record	18
Paris, FR	8
Minia, EG	3
South Kensington, GB	2
Saint Louis, US	1
Burlington, US	1

8 institutions · 243 of 243 vouchered records shown