Cibotium regale

Linden ex J.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Cyatheales/Cibotiaceae/Cibotium

At a glance

Occurrence records9

Data sources6

Biological traits7

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Cibotium regale's data was compiled from.

GBIFGlobal Biodiversity Information Facility9 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF9 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesGIFTTRY

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formF

Habitat GIFTforest

Physiology & chemistry1

Specific leaf area (SLA)10.56 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cibotium regale has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKY684774.1 ↗717 bpMexico

ACGT

AGTAATGTATCCTACATTGTTTTCCACCAATTCAGAAATTTTGAAAGAGAGAGAACTAGTTTTCATAACTATTTTGGTGTATTATCTTTA …

Cibotium regale isolate 1CiRy ATP synthase CF1 subunit beta (atpB) gene, partial cds; atpB-rbcL intergenic spacer, complete sequence; and ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4

plant barcode

08Occurrence & distribution

Record type9 records

Wild obs. + sensor2

Museum / vouchered6

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 1≤1 km 2≤10 km 1

4 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence6

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guatemala City, GT	5
Auckland, NZ	1

2 institutions · 6 of 6 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Cibotium regale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)