Chylocladia verticillata

(Lightfoot) Bliding · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Rhodymeniales/Champiaceae/Chylocladia

At a glance

Occurrence records2 995

Data sources8

Biological traits1

DNA specimens20

eDNA detections12

Sources8 archives

Databases and archives Chylocladia verticillata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 562 records↗

OBISOcean Biodiversity Information System1 433 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS2 995 records

Environmental DNA2 datasets · 4 countries12 detections

DNA & barcodingBOLD · NCBI20 specimens

01Narrative

Chylocladia verticillata is a medium-sized red marine alga.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chylocladia verticillata has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes7

GenBank sequences1

eDNA detections12

The DNA barcodea real sequence read deposited for this species

rbcLKU382046.1 ↗1 358 bpIreland · 1994

ACGT

ATATTGGGATCCTGATTATGTAGTTAAAGAAACAGATGTCTTAGCTTTGTTTCGTGTAACTCCTCAGCCAGGTGTGGATCCAATAGAAGC …

Chylocladia verticillata voucher G0210 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gastroclonium ovatumsame family11.5%Neogastroclonium subarticulatumsame family13.0%Gastroclonium reflexumsame family13.2%Asteromenia anastomosanssame order15.5%Halymenia elongatasame order15.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL1CYTB28SFL-COIPSAPSBA

animal barcodeplant barcodemitochondrialmarker

08Occurrence & distribution

Record type2 995 records

Wild obs. + sensor1 191

Museum / vouchered1 317

Other487

Origin

Native20

Range

Area of Occupancy AOO3 916 km²

Depth

0–200 m sunlit640

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5.2 m · max 40 m · 640 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 684≤1 km 146≤10 km 65

895 georeferenced · 296 without coordinates

Open the mapobservation + sensor1 191

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 116≤1 km 120≤10 km 45>10 km 29

310 georeferenced · 1 007 without coordinates

Open the institutions mapphysical evidence1 317

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Clocation not on record	90
South Kensington, GB	67
KMNlocation not on record	57
Institut Francais pour l'Etude de la Merlocation not on record	37
DASSHlocation not on record	28
Ann Arbor, US	19
486location not on record	18
LDlocation not on record	17
PNHSlocation not on record	11
Chapel Hill, US	10
MeiseBGlocation not on record	10
Acadia Universitylocation not on record	9
Barcelona, ES	6
BDBClocation not on record	4
Durham, US	4
University of Stellenboschlocation not on record	4
Burlington, US	4
Universidad de Málagalocation not on record	3
GRAlocation not on record	3
ARMS-MBONlocation not on record	3
Bourges, FR	3
Museum national d'Histoire naturellelocation not on record	3
València, ES	3
MAlocation not on record	2
Durham, US	2
Trondheim, NO	2
Auckland, NZ	2
Madrid, ES	1
Marine Biological Association of the UKlocation not on record	1
SLU Artdatabankenlocation not on record	1
Universidad de Oviedolocation not on record	1
Tampa, US	1
ISAlocation not on record	1
TROMlocation not on record	1
Uppsala, SE	1

35 institutions · 429 of 1 317 vouchered records shown · 61 without an institution code

09Environmental DNA12 detections

Where the DNA of Chylocladia verticillata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys2

Countries4

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map4 countries0

BedrockIndustrial port; industrial; 9.4 - Subtidal …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 11.7–17.0

Seasonal swing summer↔winter10.9 °C

Max temp (day)15.2 °C 12.9–20.2

Min temp (night)9.70 °C 8.40–13.4

Precipitation98.7 mm/mo 74.8–142

Air humidity62.9 % 62.2–64.1

Moisture balance11.1 mm/mo -69.7–61.2

Vapour deficit561 Pa 493–732

Wind speed3.30 m/s 2.40–6.20

Cloud cover50.4 % 38.4–52.0

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chylocladia verticillata

At a glance

Sources8 archives

Habitat & environment1

At a glance

Record type2 995 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 995 records