Chylismia claviformis

(Torr. & Frém.) A.Heller · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Chylismia

At a glance

Occurrence records4 635

Data sources11

Biological traits17

DNA specimens6

eDNA detections3

Sources11 archives

Databases and archives Chylismia claviformis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 635 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF4 635 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Chylismia claviformis is a species of wildflower known as browneyes or brown-eyed primrose native to North America. This species is found across western North America from the Pacific Northwest to northern Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.127 mg

⚠ sources differ — TRY: 0.127 mg · GIFT: 0.134 mg

Seed mass max0.27 mg

Seed mass min0.054 mg

Life cycle & reproduction4

DeciduousnessN

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf n35.4 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)13 mm²/mg

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chylismia claviformis has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences1

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY271541.1 ↗599 bp

ACGT

TCAATCCTGCACAACAGAACAACCCGAGAACCGGTTAACAACCACTTGGGAGACTGGGGCAAGTCCCCTGCGCTCCCAAATCCCGCTGTA …

Camissonia claviformis internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Chylismia claviformis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 721×CCDB · book-ipcn67-71 · CCDB · Cave1958 · CCDB · Cave1962

CCDB · book-ipcn67-71 — RAVEN, P.H. 1969. A revision of the genus Camissonia (Onagraceae). Contrib. U.S. Nat. Herb. 37(5): 161-396.

CCDB · Cave1958 — Lewis et al. 1958

CCDB · Cave1962 — Raven 1962b

n 61×CCDB · book-ipcn65

CCDB · book-ipcn65 — Bell 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 635 records

Wild obs. + sensor4 431

Museum / vouchered204

Origin

Native3

Range

Area of Occupancy AOO6 872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 2 397≤1 km 364≤10 km 195>10 km 160

3 116 georeferenced · 1 315 without coordinates

Open the mapobservation + sensor4 431

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 4≤1 km 42≤10 km 31>10 km 10

87 georeferenced · 117 without coordinates

Open the institutions mapphysical evidence204

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	23
Davis, US	22
San Luis Obispo, US	18
ASUlocation not on record	17
US	15
Claremont, US	13
Pullman, US	13
San Diego, US	10
Northridge, US	9
Riverside, US	7
Provo, US	7
Flagstaff, US	6
Severin-McDaniel Insect Collectionlocation not on record	5
San Jose, US	4
Canadian Department of Agriculturelocation not on record	3
Arizona Western Collegelocation not on record	3
Bend, US	3
Los Angeles, US	2
University of Stellenboschlocation not on record	2
Caldwell, US	2
Musee des Dinosaures d'Esperaza (Aude)location not on record	2
Dekalb, US	2
Austin, US	1
Long Beach, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Saint Louis, US	1
Corvallis, US	1
Boise, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Phoenix, US	1
Turlock, US	1
Uniwersytet Jagiellońskilocation not on record	1
Logan, US	1
Denver, US	1

34 institutions · 200 of 204 vouchered records shown · 4 without an institution code

09Environmental DNA3 detections

Where the DNA of Chylismia claviformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

sandy desert flat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 15.7–18.1

Seasonal swing summer↔winter19.2 °C

Max temp (day)22.9 °C 22.0–23.8

Min temp (night)10.6 °C 9.30–11.8

Precipitation30.4 mm/mo 22.7–38.1

Air humidity45.2 % 43.2–47.1

Moisture balance-102 mm/mo -123–-80.7

Vapour deficit1,069 Pa 953–1,184

Wind speed3.50 m/s 3.20–3.80

Cloud cover36.9 % 36.2–37.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chylismia claviformis

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction4

Diet & foraging1

Habitat & environment6

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 635 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions25 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 635 records