Chrysops relictus

Meigen, 1820 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Chrysops

At a glance

Occurrence records21 450

Data sources10

Biological traits2

DNA specimens35

eDNA detections1

Sources10 archives

Databases and archives Chrysops relictus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 450 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF21 450 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD35 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈353 Mbp

01Narrative

miniatur|Weibchen Die Goldaugenbremse (Chrysops relictus) ist eine Fliege aus der Familie der Bremsen (Tabanidae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)predator

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysops relictus has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections1

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

322Amostly conserved

340Cmostly conserved

347Cmostly conserved

433Gmostly conserved

562Tmostly conserved

622Amostly conserved

AACACTTTACTTTATTTTCGGAGCATGAGCCGGAATAATTGGAACTTCTTTAAGTATTTTAATTCGTGCTGAACTAGGACACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes8

BIN1

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysops rufipessame genus3.3%Chrysops viduatussame genus4.9%Chrysops divaricatussame genus5.0%Chrysops frigidussame genus5.0%Chrysops sepulcralissame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Chrysops relictus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈352 754 745 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Chrysops relictus0.35 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Chromosome records10–102n range10median10mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 104×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Altunsoy, F. and A. Y. Kilic (2010). "Karyotype characterization of some Tabanidae (Diptera) species." Turkiye Entomoloji Dergisi-Turkish Journal Of Entomology 34(4): 477-494. ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness95.5% BUSCO

08Occurrence & distribution

Record type21 450 records

Wild obs. + sensor19 274

Museum / vouchered2 170

Other6

Range

Area of Occupancy AOO30 808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 5 133≤1 km 2 445≤10 km 9 470>10 km 50

17 098 georeferenced · 2 176 without coordinates

Open the mapobservation + sensor19 274

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 319≤1 km 722≤10 km 532>10 km 22

1 595 georeferenced · 575 without coordinates

Open the institutions mapphysical evidence2 170

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	630
Helsinki, FI	381
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	216
NHMOlocation not on record	199
SLU Artdatabankenlocation not on record	110
Gothenburg, SE	93
Tromsø, NO	89
Tilburg, NL	63
ZMAAlocation not on record	60
University of Tokyo, Department of Zoologylocation not on record	58
RMZlocation not on record	35
CBDClocation not on record	22
Philadelphia, US	20
Kuopio, FI	18
BioFokuslocation not on record	16
Stockholm, SE	14
Natural History Museum Rotterdamlocation not on record	12
UNHClocation not on record	9
Metsähallituslocation not on record	8
South Kensington, GB	7
NTNU-VMlocation not on record	6
DFFW1981location not on record	5
neflocation not on record	5
Natural History Museum, Londonlocation not on record	5
NMOKlocation not on record	5
DFFW2016location not on record	4
NCMGlocation not on record	4
Rovaniemi, FI	4
ZSMlocation not on record	4
DFlocation not on record	2
Mississippi State, US	2
DFFW2018location not on record	2
Uniwersytet Łódzkilocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Tartu, EE	1
Ugentlocation not on record	1

36 institutions · 2 112 of 2 170 vouchered records shown · 58 without an institution code

09Environmental DNA1 detections

Where the DNA of Chrysops relictus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 17.9–17.9

Seasonal swing summer↔winter18.6 °C

Max temp (day)22.1 °C

Min temp (night)13.4 °C

Precipitation121 mm/mo

Air humidity60.6 %

Moisture balance9.80 mm/mo

Vapour deficit809 Pa

Wind speed2.80 m/s

Cloud cover35.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chrysops relictus

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type21 450 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type21 450 records