Chrysocraspeda abhadraca

(Walker, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Chrysocraspeda

At a glance

Occurrence records33

Data sources8

Biological traits0

DNA specimens8

eDNA detections4

Sources8 archives

Databases and archives Chrysocraspeda abhadraca's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD8 specimens

01Narrative

Chrysocraspeda abhadraca is a species of moth in the family Geometridae described by Francis Walker in 1861. It is found in Indian subregion including India and Sri Lanka, Peninsular Malaysia, Sumatra and Borneo.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysocraspeda abhadraca has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

78Amostly conserved

85Amostly conserved

97Gmostly conserved

100Cmostly conserved

124Amostly conserved

163Amostly conserved

265Avariable

268Cvariable

349Tvariable

361Tvariable

364Tvariable

397Tvariable

430Avariable

460Cvariable

491Tvariable

535Cvariable

541Avariable

544Tvariable

545Cvariable

547Gvariable

553Tvariable

562Avariable

577Cvariable

610Tmostly conserved

611Gmostly conserved

612Amostly conserved

616Cvariable

646Avariable

652Amostly conserved

ATTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACCTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAACCCAGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes3

BINs2

Most divergent pair3.5%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Xanthorhoe labradorensissame family7.7%Xanthorhoe designatasame family7.7%Lophophelma vigenssame family7.8%Eois spnrsame family8.3%Maxates panterpnasame family8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type33 records

Wild obs. + sensor32

Museum / vouchered1

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 9≤1 km 6≤10 km 4>10 km 5

24 georeferenced · 8 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ZSMlocation not on record	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Chrysocraspeda abhadraca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 24.7–25.6

Seasonal swing summer↔winter1.20 °C

Max temp (day)28.7 °C 27.7–28.8

Min temp (night)21.5 °C 20.7–21.7

Precipitation276 mm/mo 208–284

Air humidity68.4 % 66.8–69.1

Moisture balance132 mm/mo 76.1–139

Vapour deficit1,014 Pa 1,008–1,033

Wind speed1.20 m/s 1.20–1.30

Cloud cover59.9 % 45.2–64.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)