Chrysocrambus linetella

Fabricius, 1781 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Chrysocrambus

At a glance

Occurrence records2 821

Data sources6

Biological traits0

DNA specimens15

eDNA detections1

Sources6 archives

Databases and archives Chrysocrambus linetella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 821 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 821 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD15 specimens

01Narrative

Chrysocrambus linetella is a species of moth in the family Crambidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysocrambus linetella has left across the world's sequence archives.

At a glance

DNA specimens15

BINs3

Marker genes3

eDNA detections1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

14Cmostly conserved

17Cmostly conserved

20Gmostly conserved

47Tmostly conserved

48Cmostly conserved

50Amostly conserved

122Tmostly conserved

188Amostly conserved

215Gmostly conserved

218Amostly conserved

233Cmostly conserved

245Tmostly conserved

269Amostly conserved

292Cmostly conserved

368Tmostly conserved

383Cmostly conserved

398Gmostly conserved

401Gmostly conserved

431Amostly conserved

449Cmostly conserved

458Tmostly conserved

461Cmostly conserved

467Cmostly conserved

515Amostly conserved

527Cmostly conserved

551Amostly conserved

560Cmostly conserved

576Tmostly conserved

599Cmostly conserved

626Amostly conserved

CTTTATATTTTATCTTCGGGGTATGAGCTGGAATAATAGGAACATCTCTAAGATTATTAATTCGAGCTGAATTAGGAAATCCCGGATCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.89%

Haplotypes3

BINs3

Most divergent pair3.8%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chrysocrambus dentuellussame genus5.8%Xanthocrambus lucellussame family8.6%Agriphila dalmatinellussame family9.2%Xanthocrambus saxonellussame family9.2%Catoptria staudingerisame family9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PND3ND6

animal barcodemitochondrial

08Occurrence & distribution

Record type2 821 records

Wild obs. + sensor2 746

Museum / vouchered73

Other2

Range

Area of Occupancy AOO5 392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 978≤1 km 187≤10 km 721>10 km 114

2 000 georeferenced · 746 without coordinates

Open the mapobservation + sensor2 746

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 2≤1 km 9≤10 km 55

66 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	29
Tartu, EE	4
Radicondoli, IT	2

3 institutions · 35 of 73 vouchered records shown · 38 without an institution code

09Environmental DNA1 detections

Where the DNA of Chrysocrambus linetella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chrysocrambus linetella

At a glance

Sources6 archives

At a glance

Record type2 821 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 3 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 821 records