Chrysocolaptes lucidus

(Scopoli, 1786) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Piciformes/Picidae/Chrysocolaptes

At a glance

Occurrence records1 511

Data sources7

Biological traits30

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Chrysocolaptes lucidus's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 511 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Occurrence & distributionGBIF1 511 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

The buff-spotted flameback (Chrysocolaptes lucidus) is a species of bird in the family Picidae. It is found on the Philippine islands of Bohol, Leyte, Samar, Biliran, Panaon, Mindanao, Basilan, and Samal. It is sometimes considered a subspecies of the greater flameback.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology14

Beak depth10.9 mm

Beak length (culmen)45.1 mm

Beak length (nares)34.5 mm

Beak width10.5 mm

Body mass171 g

⚠ sources differ — AmnioteDB: 171 g · AVONET: 142 g · EltonTraits: 142 g

Body mass (female)174 g

Body mass (male)211 g

Hand-wing index19.9

Kipp's distance30.4 mm

SVL31 cm

Secondary length123 mm

Tail length90.9 mm

Tarsus length29.4 mm

Wing length153 mm

Life cycle & reproduction4

Egg mass8 g

Fledging age25 days

Incubation14.75 days

Litter size3.2

Diet & foraging8

Canopy30 %

Ground10 %

Invertebrate80 %

Midhigh40 %

Nectar20 %

Trophic levelcarnivore

Trophic nicheInvertivore

Understory20 %

Habitat & environment4

HabitatWoodland

Migration1.0

Primary lifestyleInsessorial

Range size119 803 km²

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysocolaptes lucidus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Diversity (π)5.5%

Haplotypes2

BINs2

Most divergent pair2.9%

Where individuals differ — all 87 variable positions, in barcode order

1Cmostly conserved

2Tmostly conserved

3Amostly conserved

4Tmostly conserved

5Amostly conserved

7Cmostly conserved

10Amostly conserved

13Tmostly conserved

14Tmostly conserved

17Gmostly conserved

18Cmostly conserved

19Gmostly conserved

20Cmostly conserved

22Tmostly conserved

23Gmostly conserved

24Amostly conserved

26Cmostly conserved

27Tmostly conserved

28Gmostly conserved

29Gmostly conserved

30Cmostly conserved

33Amostly conserved

34Amostly conserved

35Tmostly conserved

37Gmostly conserved

38Gmostly conserved

39Cmostly conserved

40Amostly conserved

42Amostly conserved

43Gmostly conserved

44Cmostly conserved

46Cmostly conserved

47Tmostly conserved

49Amostly conserved

50Gmostly conserved

51Cmostly conserved

54Amostly conserved

55Cmostly conserved

58Amostly conserved

59Tmostly conserved

61Cmostly conserved

62Gmostly conserved

63Cmostly conserved

65Cmostly conserved

66Tmostly conserved

67Gmostly conserved

68Amostly conserved

70Cmostly conserved

71Tmostly conserved

72Amostly conserved

73Gmostly conserved

74Gmostly conserved

75Cmostly conserved

77Amostly conserved

78Avariable

79Cmostly conserved

80Cmostly conserved

81Tmostly conserved

82Gmostly conserved

83Gmostly conserved

84Cmostly conserved

85Amostly conserved

86Cmostly conserved

90Tmostly conserved

91Cmostly conserved

92Tmostly conserved

93Tmostly conserved

95Gmostly conserved

105Gmostly conserved

132Tmostly conserved

231Cmostly conserved

261Tmostly conserved

306Gvariable

327Avariable

354Cmostly conserved

355Cmostly conserved

357Amostly conserved

360Cmostly conserved

381Tmostly conserved

387Tmostly conserved

402Tmostly conserved

468Gmostly conserved

483Amostly conserved

570Gmostly conserved

600Tmostly conserved

624Avariable

627Cmostly conserved

CTATACCTCATCTTCGGCGCATGAGCTGGCATAATCGGCACAGCCCTCAGCCTACTCATCCGCGCTGAACTAGGCCAACCTGGCACTCTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Campephilus leucopogonsame family9.1%Campephilus rubricollissame family9.5%Campephilus melanoleucossame family10.1%Melanerpes formicivorussame family10.4%Colaptes rupicolasame family10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 511 records

Wild obs. + sensor1 427

Museum / vouchered79

Other5

Origin

Native2

Range

Area of Occupancy AOO872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 9≤1 km 13≤10 km 2>10 km 6

30 georeferenced · 1 397 without coordinates

Open the mapobservation + sensor1 427

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤1 km 4≤10 km 6>10 km 12

22 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	18
Honolulu, US	10
Cambridge, US	9
Denver, US	7
Ann Arbor, US	6
Edmonton, CA	2
Bourges, FR	2
Philadelphia, US	1
Iowa City, US	1
Washington, US	1
Seattle, US	1

11 institutions · 58 of 79 vouchered records shown · 21 without an institution code

09Environmental DNA5 detections

Where the DNA of Chrysocolaptes lucidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.7 °C 20.5–28.9

Seasonal swing summer↔winter4.50 °C

Max temp (day)30.0 °C 23.2–32.6

Min temp (night)24.9 °C 16.9–25.5

Precipitation135 mm/mo 114–299

Air humidity63.6 % 63.5–66.6

Moisture balance-29.8 mm/mo

Vapour deficit1,356 Pa 838–1,444

Wind speed2.80 m/s

Cloud cover46.1 % 31.5–50.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chrysocolaptes lucidus

At a glance

Sources7 archives

Size & morphology14

Life cycle & reproduction4

Diet & foraging8

Habitat & environment4

At a glance

Record type1 511 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 511 records