Chrysococcyx minutillus

Gould, 1859 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Cuculiformes/Cuculidae/Chrysococcyx

At a glance

Occurrence records1 942

Data sources8

Biological traits23

DNA specimens43

eDNA detections43

Sources8 archives

Databases and archives Chrysococcyx minutillus's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 942 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF1 942 records

Environmental DNA1 datasets · 1 countries43 detections

DNA & barcodingBOLD43 specimens

01Narrative

The little bronze cuckoo (Chrysococcyx minutillus) is a species of cuckoo in the family Cuculidae. It is found in Southeast Asia, New Guinea and northern and eastern Australia, where its natural habitat is subtropical or tropical moist lowland forest. It is the world's smallest cuckoo, at 17 g and 15 cm. The subspecies rufomerus and crassirostris are sometimes given specific status.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology13

Beak depth4.7 mm

Beak length (culmen)18.8 mm

Beak length (nares)12.2 mm

Beak width5.1 mm

Body mass18.62 g

Body mass (female)17.65 g

Body mass (male)16.9 g

Hand-wing index37.7

Kipp's distance35.4 mm

Secondary length58.5 mm

Tail length59.6 mm

Tarsus length14.7 mm

Wing length93.2 mm

Life cycle & reproduction1

Litter size1

Diet & foraging5

Canopy80 %

Invertebrate100 %

Midhigh20 %

Trophic levelcarnivore

Trophic nicheInvertivore

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size2 896 886 km²

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Chrysococcyx minutillus has left across the world's sequence archives.

At a glance

DNA specimens43

Marker genes1

eDNA detections43

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 551 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

300Tmostly conserved

451Cmostly conserved

589Tmostly conserved

592Tmostly conserved

639Cmostly conserved

816Amostly conserved

918Cvariable

942Cmostly conserved

1305Cvariable

GTGACTTTCATAACCCGATGACTATTCTCAACTAACCACAAAGACATTGGCACTCTATACCTAATCTTCGGTGCCTGAGCAGGCATAGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.20%

Haplotypes4

BINs0

Most divergent pair0.13%

Oceania

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_087725 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND612S ribosomal RNA16S ribosomal RNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 942 records

Wild obs. + sensor1 875

Museum / vouchered67

Origin

Native6

Range

Area of Occupancy AOO2 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤1 km 1 258≤10 km 460>10 km 79

1 797 georeferenced · 78 without coordinates

Open the mapobservation + sensor1 875

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	8
Honolulu, US	4
Seattle, US	1

3 institutions · 13 of 67 vouchered records shown · 29 without an institution code

09Environmental DNA43 detections

Where the DNA of Chrysococcyx minutillus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 21.5–26.7

Seasonal swing summer↔winter6.40 °C

Max temp (day)26.9 °C 24.8–30.2

Min temp (night)21.8 °C 17.1–23.8

Precipitation73.2 mm/mo 27.8–167

Air humidity63.4 % 58.9–65.4

Moisture balance-84.0 mm/mo -132–21.3

Vapour deficit1,095 Pa 947–1,356

Wind speed2.50 m/s 1.40–3.10

Cloud cover35.6 % 30.1–64.5

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Chrysococcyx minutillus

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction1

Diet & foraging5

Habitat & environment4

At a glance

Record type1 942 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 3 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 942 records